Incidental Mutation 'R2291:Cyp27b1'
ID244361
Institutional Source Beutler Lab
Gene Symbol Cyp27b1
Ensembl Gene ENSMUSG00000006724
Gene Namecytochrome P450, family 27, subfamily b, polypeptide 1
SynonymsCyp27b, Vdd1, 25(OH)D 1alpha-hydroxylase, 1alpha(OH)ase, P450VD1alpha, 25-hydroxyvitamin D3 1alpha-hydroxylase, Cyp40, Cp2b, Cyp1, VddrI, Pddr, P450c1, Vddr
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127048250-127053006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127048294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 5 (V5A)
Ref Sequence ENSEMBL: ENSMUSP00000127367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006915] [ENSMUST00000120542] [ENSMUST00000165764] [ENSMUST00000172069]
Predicted Effect probably benign
Transcript: ENSMUST00000006915
SMART Domains Protein: ENSMUSP00000006915
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
Pfam:Methyltransf_4 70 248 3.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120542
SMART Domains Protein: ENSMUSP00000113030
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
Pfam:Methyltransf_4 29 191 3.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135655
Predicted Effect probably benign
Transcript: ENSMUST00000139486
SMART Domains Protein: ENSMUSP00000118885
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
PDB:3CKK|A 24 85 3e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165764
AA Change: V5A

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130005
Gene: ENSMUSG00000006724
AA Change: V5A

DomainStartEndE-ValueType
Pfam:p450 40 504 7.1e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171868
Predicted Effect possibly damaging
Transcript: ENSMUST00000172069
AA Change: V5A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the inner mitochondrial membrane where it hydroxylates 25-hydroxyvitamin D3 at the 1alpha position. This reaction synthesizes 1alpha,25-dihydroxyvitamin D3, the active form of vitamin D3, which binds to the vitamin D receptor and regulates calcium metabolism. Thus this enzyme regulates the level of biologically active vitamin D and plays an important role in calcium homeostasis. Mutations in this gene can result in vitamin D-dependent rickets type I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit hypocalcemia, hyperparathyroidism, retarded growth, enlarged lymph nodes, and rickets. Females have uterine hypoplasia and lack corpora lutea, resulting in infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Cyp27b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyp27b1 APN 10 127049682 missense probably benign 0.19
IGL01147:Cyp27b1 APN 10 127050386 missense possibly damaging 0.94
IGL02370:Cyp27b1 APN 10 127050674 splice site probably benign
IGL02670:Cyp27b1 APN 10 127050358 missense probably benign 0.01
IGL02671:Cyp27b1 APN 10 127051043 unclassified probably null
R0483:Cyp27b1 UTSW 10 127050157 missense probably benign 0.02
R0517:Cyp27b1 UTSW 10 127050116 unclassified probably null
R0645:Cyp27b1 UTSW 10 127049098 missense probably benign 0.02
R1479:Cyp27b1 UTSW 10 127051711 critical splice donor site probably null
R1491:Cyp27b1 UTSW 10 127051088 missense probably damaging 0.98
R1830:Cyp27b1 UTSW 10 127049083 missense possibly damaging 0.92
R1929:Cyp27b1 UTSW 10 127048312 missense probably damaging 1.00
R2162:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R2281:Cyp27b1 UTSW 10 127048294 missense probably damaging 0.99
R3831:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R3832:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R3833:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R4306:Cyp27b1 UTSW 10 127051088 missense probably benign 0.21
R5213:Cyp27b1 UTSW 10 127052095 missense probably damaging 1.00
R5405:Cyp27b1 UTSW 10 127050386 missense possibly damaging 0.94
R5463:Cyp27b1 UTSW 10 127052097 missense possibly damaging 0.89
R5906:Cyp27b1 UTSW 10 127048398 missense probably damaging 1.00
R6181:Cyp27b1 UTSW 10 127050410 missense probably damaging 1.00
R6515:Cyp27b1 UTSW 10 127048250 start gained probably benign
R7249:Cyp27b1 UTSW 10 127051049 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGGGTGCTGAGCTACAC -3'
(R):5'- TGCCATTAAAGCCGGCTCTC -3'

Sequencing Primer
(F):5'- TGCTGAGCTACACAGACCACTTG -3'
(R):5'- TCCTACCAAGGGCAAGGACTG -3'
Posted On2014-10-30