Mutagenetix > Incidental Mutations

Incidental Mutation 'R2291:Otx1'

244363

Institutional Source

Beutler Lab

Gene Symbol

Otx1

Ensembl Gene

ENSMUSG00000005917

Gene Name

orthodenticle homeobox 1

Synonyms

A730044F23Rik, jv

MMRRC Submission

040290-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.846) question?

Stock #

R2291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21994764-22002897 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 21996634 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]

Predicted Effect

unknown
Transcript: ENSMUST00000006071
AA Change: Y225F

SMART Domains

Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: Y225F

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
Pfam:TF_Otx	178	279	2.5e-39	PFAM
internal_repeat_1	310	322	1.39e-7	PROSPERO
low complexity region	324	331	N/A	INTRINSIC
internal_repeat_1	334	346	1.39e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000147486

SMART Domains

Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172395

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Cfap65	G	A	1: 74,926,475	P459S	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Chl1	T	A	6: 103,715,393	Y331N	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cspg4	T	C	9: 56,892,743	V1597A	probably damaging	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Scn1a	A	G	2: 66,288,968	L1397P	probably benign	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Otx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Otx1	APN	11	21996794	unclassified	probably benign
Embarrassed	UTSW	11	21997037	missense	probably damaging	1.00
R1946:Otx1	UTSW	11	21998482	missense	probably damaging	1.00
R2870:Otx1	UTSW	11	21998681	intron	probably benign
R4164:Otx1	UTSW	11	21996638	unclassified	probably benign
R4845:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4925:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4934:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4993:Otx1	UTSW	11	21998532	splice site	probably null
R5061:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5062:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5063:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5068:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5069:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5070:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5097:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5169:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5170:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5171:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5172:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5198:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5199:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5200:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5201:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5202:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5203:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5204:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5205:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5256:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5267:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5360:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5361:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5363:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5372:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5375:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5380:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5381:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5382:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5383:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5415:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5416:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5534:Otx1	UTSW	11	21996296	unclassified	probably benign
R5592:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5594:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5725:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5727:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5735:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5736:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5841:Otx1	UTSW	11	21998594	intron	probably benign
R5940:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5941:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6080:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6081:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6093:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6126:Otx1	UTSW	11	21996457	unclassified	probably benign
R6131:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6132:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6134:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6187:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6220:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6269:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6270:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6271:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6272:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6396:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6619:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6624:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6680:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6681:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6718:Otx1	UTSW	11	21996412	unclassified	probably benign
R6831:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6834:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6985:Otx1	UTSW	11	21996615	nonsense	probably null
R7631:Otx1	UTSW	11	21999458	nonsense	probably null
R8100:Otx1	UTSW	11	21999392	missense	probably benign	0.16
X0054:Otx1	UTSW	11	21996331	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCTGAAGATTGGCTCAGTG -3'
(R):5'- AGAAGTCGTCTCCAGTACGC -3'

Sequencing Primer
(F):5'- AAGATTGGCTCAGTGGGTGG -3'
(R):5'- TCTAGCTCAGCGTCCAGTG -3'

Posted On

2014-10-30