Incidental Mutation 'R2291:Spdl1'
ID244364
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Namespindle apparatus coiled-coil protein 1
Synonyms
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location34809190-34833641 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34819309 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 382 (K382*)
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
Predicted Effect probably null
Transcript: ENSMUST00000093191
AA Change: K382*
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: K382*

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34813354 missense probably benign 0.27
IGL02694:Spdl1 APN 11 34813621 missense probably benign 0.05
IGL03131:Spdl1 APN 11 34830765 missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34823520 missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34819290 missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34813607 missense unknown
R1315:Spdl1 UTSW 11 34813407 missense unknown
R1799:Spdl1 UTSW 11 34821029 nonsense probably null
R2002:Spdl1 UTSW 11 34822646 missense probably benign
R4771:Spdl1 UTSW 11 34813327 missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34823440 missense probably benign 0.00
R5167:Spdl1 UTSW 11 34813360 missense possibly damaging 0.79
R5477:Spdl1 UTSW 11 34822210 missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34822570 missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34823003 intron probably null
R6714:Spdl1 UTSW 11 34823003 intron probably null
R6980:Spdl1 UTSW 11 34830879 start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34823364 missense not run
R7791:Spdl1 UTSW 11 34813477 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTCCCAATCTGAAAGGTAAGAGCC -3'
(R):5'- CAAGGATTTGTAAAAGTCTTGTGGAGG -3'

Sequencing Primer
(F):5'- CCGGTTCATACTTCAGCTTGAG -3'
(R):5'- AAAAGTCTTGTGGAGGTTGCATTG -3'
Posted On2014-10-30