Incidental Mutation 'R2291:N4bp3'
ID244365
Institutional Source Beutler Lab
Gene Symbol N4bp3
Ensembl Gene ENSMUSG00000001053
Gene NameNEDD4 binding protein 3
SynonymsC330016O10Rik
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51643063-51650842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51646103 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 48 (K48E)
Ref Sequence ENSEMBL: ENSMUSP00000001080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001080] [ENSMUST00000064493] [ENSMUST00000117859] [ENSMUST00000142721] [ENSMUST00000156835]
Predicted Effect probably damaging
Transcript: ENSMUST00000001080
AA Change: K48E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001080
Gene: ENSMUSG00000001053
AA Change: K48E

DomainStartEndE-ValueType
low complexity region 176 207 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
coiled coil region 295 334 N/A INTRINSIC
Pfam:Fez1 359 442 2.3e-21 PFAM
Pfam:Fez1 433 519 4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064493
SMART Domains Protein: ENSMUSP00000069562
Gene: ENSMUSG00000052563

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117859
SMART Domains Protein: ENSMUSP00000113687
Gene: ENSMUSG00000052563

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142721
AA Change: K48E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000156835
AA Change: K48E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in N4bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:N4bp3 APN 11 51645316 missense probably benign 0.28
IGL02130:N4bp3 APN 11 51643946 missense possibly damaging 0.77
IGL02265:N4bp3 APN 11 51643818 missense probably benign 0.14
IGL02516:N4bp3 APN 11 51644334 missense probably benign 0.00
R1435:N4bp3 UTSW 11 51644340 missense probably damaging 0.97
R2270:N4bp3 UTSW 11 51644305 missense probably benign 0.00
R3236:N4bp3 UTSW 11 51645934 missense probably damaging 1.00
R3237:N4bp3 UTSW 11 51645934 missense probably damaging 1.00
R4695:N4bp3 UTSW 11 51644479 unclassified probably null
R5154:N4bp3 UTSW 11 51645312 missense probably benign 0.09
R5839:N4bp3 UTSW 11 51646082 missense probably benign
R6632:N4bp3 UTSW 11 51643949 missense possibly damaging 0.94
R7346:N4bp3 UTSW 11 51645606 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCATCACAGTCTCTGAGCTG -3'
(R):5'- ATTCCCAGAATCAGCTGCC -3'

Sequencing Primer
(F):5'- GATGCACCTTGTCAAAGCG -3'
(R):5'- TGCCCGAGCCCTGTTGAAC -3'
Posted On2014-10-30