Incidental Mutation 'R2291:Cacna1d'
ID244378
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30042342 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 2078 (R2078S)
Ref Sequence ENSEMBL: ENSMUSP00000107869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000118917] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably benign
Transcript: ENSMUST00000067620
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112249
AA Change: R2056S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: R2056S

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: R2078S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: R2078S

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118917
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223573
Predicted Effect possibly damaging
Transcript: ENSMUST00000223803
AA Change: R2056S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224198
AA Change: R2091S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: R2047S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
Brisk UTSW 14 30171314 missense possibly damaging 0.91
Troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense probably damaging 1.00
R7613:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7661:Cacna1d UTSW 14 30047220 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AATCATCTCATCTGCCAGGTC -3'
(R):5'- TTCGACACCAACAGAGCTGAG -3'

Sequencing Primer
(F):5'- AAAGTCCTGGAGCTCATAGTCCTG -3'
(R):5'- AGCTGAGCTCATTTATGGTTAGCATC -3'
Posted On2014-10-30