Incidental Mutation 'R2291:Diaph3'
ID244381
Institutional Source Beutler Lab
Gene Symbol Diaph3
Ensembl Gene ENSMUSG00000022021
Gene Namediaphanous related formin 3
Synonyms4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location86655367-87141235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86966446 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 592 (P592Q)
Ref Sequence ENSEMBL: ENSMUSP00000129420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889] [ENSMUST00000228000]
Predicted Effect probably damaging
Transcript: ENSMUST00000022599
AA Change: P592Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021
AA Change: P592Q

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.88e-180 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168889
AA Change: P592Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021
AA Change: P592Q

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.2e-181 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227666
Predicted Effect probably damaging
Transcript: ENSMUST00000228000
AA Change: P581Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Diaph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Diaph3 APN 14 87002871 missense probably benign
IGL00809:Diaph3 APN 14 87000027 missense probably damaging 0.98
IGL01419:Diaph3 APN 14 86965553 nonsense probably null
IGL01577:Diaph3 APN 14 86906031 missense probably damaging 0.99
IGL01718:Diaph3 APN 14 86656338 missense unknown
IGL01736:Diaph3 APN 14 86918846 missense probably benign 0.01
IGL01893:Diaph3 APN 14 86918852 missense possibly damaging 0.71
IGL02316:Diaph3 APN 14 86986115 missense possibly damaging 0.88
IGL02527:Diaph3 APN 14 86810359 missense possibly damaging 0.47
IGL02586:Diaph3 APN 14 86986076 nonsense probably null
IGL02749:Diaph3 APN 14 86918825 missense probably damaging 0.99
IGL02892:Diaph3 APN 14 86866630 nonsense probably null
IGL03069:Diaph3 APN 14 86772119 missense probably damaging 1.00
IGL03191:Diaph3 APN 14 87073302 missense possibly damaging 0.75
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0011:Diaph3 UTSW 14 86866408 missense probably damaging 1.00
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0285:Diaph3 UTSW 14 87115024 missense possibly damaging 0.86
R0359:Diaph3 UTSW 14 86969502 missense probably benign 0.26
R0505:Diaph3 UTSW 14 87090964 splice site probably benign
R0551:Diaph3 UTSW 14 86910100 missense probably benign 0.45
R1295:Diaph3 UTSW 14 87007399 missense probably damaging 1.00
R1539:Diaph3 UTSW 14 86656480 missense probably damaging 1.00
R1602:Diaph3 UTSW 14 87091158 splice site probably benign
R1725:Diaph3 UTSW 14 86966323 critical splice donor site probably null
R1745:Diaph3 UTSW 14 86966560 missense probably damaging 0.96
R1747:Diaph3 UTSW 14 87073337 missense probably damaging 0.98
R1772:Diaph3 UTSW 14 86965549 missense probably damaging 1.00
R1914:Diaph3 UTSW 14 86656485 missense probably damaging 0.98
R1942:Diaph3 UTSW 14 87141120 utr 5 prime probably benign
R1999:Diaph3 UTSW 14 86984866 missense possibly damaging 0.53
R2999:Diaph3 UTSW 14 86772094 missense probably damaging 0.99
R3158:Diaph3 UTSW 14 86656456 missense possibly damaging 0.84
R3612:Diaph3 UTSW 14 87037457 missense probably null 0.89
R4170:Diaph3 UTSW 14 86985707 missense probably damaging 1.00
R4594:Diaph3 UTSW 14 86986037 missense probably damaging 0.99
R4912:Diaph3 UTSW 14 87007199 missense probably damaging 1.00
R4930:Diaph3 UTSW 14 87141166 start gained probably benign
R5063:Diaph3 UTSW 14 86984870 missense probably damaging 1.00
R5093:Diaph3 UTSW 14 86984800 missense probably damaging 1.00
R5267:Diaph3 UTSW 14 86656553 missense probably benign 0.03
R5289:Diaph3 UTSW 14 86981678 missense probably damaging 1.00
R5549:Diaph3 UTSW 14 86978670 missense probably benign 0.14
R5936:Diaph3 UTSW 14 86772116 missense possibly damaging 0.53
R5966:Diaph3 UTSW 14 86984825 missense probably damaging 1.00
R6236:Diaph3 UTSW 14 87037568 nonsense probably null
R6323:Diaph3 UTSW 14 86966453 missense probably benign 0.03
R6331:Diaph3 UTSW 14 86866540 missense probably damaging 1.00
R6362:Diaph3 UTSW 14 86772130 missense probably damaging 1.00
R6398:Diaph3 UTSW 14 86866486 missense probably damaging 1.00
R6408:Diaph3 UTSW 14 86828994 missense possibly damaging 0.68
R6469:Diaph3 UTSW 14 86656538 missense possibly damaging 0.71
R6519:Diaph3 UTSW 14 86966335 missense probably damaging 1.00
R7261:Diaph3 UTSW 14 86965457 missense probably benign 0.04
R7283:Diaph3 UTSW 14 86866584 missense probably damaging 1.00
R7782:Diaph3 UTSW 14 87037504 missense probably benign 0.00
R7811:Diaph3 UTSW 14 86981624 missense probably damaging 1.00
R8012:Diaph3 UTSW 14 87037522 missense not run
R8024:Diaph3 UTSW 14 86656399 missense not run
R8065:Diaph3 UTSW 14 87037495 missense not run
Z1176:Diaph3 UTSW 14 86656432 missense not run
Z1177:Diaph3 UTSW 14 87002814 missense not run
Predicted Primers PCR Primer
(F):5'- GTCATTATGAGGAGTTCCCATTGG -3'
(R):5'- TAGTTTGGTGCCTTGCCAC -3'

Sequencing Primer
(F):5'- TATGCCTGATCCCACTAG -3'
(R):5'- GCCACCTGGTACAAAAATTCCTTTG -3'
Posted On2014-10-30