Incidental Mutation 'R2291:Afdn'
ID244387
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Nameafadin, adherens junction formation factor
SynonymsAfadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location13760539-13906150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13888891 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1559 (K1559E)
Ref Sequence ENSEMBL: ENSMUSP00000122447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124188
Predicted Effect unknown
Transcript: ENSMUST00000137531
AA Change: K121E
SMART Domains Protein: ENSMUSP00000116711
Gene: ENSMUSG00000068036
AA Change: K121E

DomainStartEndE-ValueType
coiled coil region 70 110 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137708
AA Change: K1574E

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: K1574E

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: K1581E

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: K1581E

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: K1574E

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: K1574E

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150848
AA Change: K1559E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: K1559E

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: K1559E

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: K1559E

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7581:Afdn UTSW 17 13849238 missense probably damaging 1.00
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
R8694:Afdn UTSW 17 13888379 missense probably benign
R8728:Afdn UTSW 17 13898945 missense probably damaging 1.00
R8770:Afdn UTSW 17 13883937 critical splice donor site probably null
R8887:Afdn UTSW 17 13896139 nonsense probably null
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCCTGGAAACGAGATG -3'
(R):5'- GTTGTCAGCCAAGAGTGAGC -3'

Sequencing Primer
(F):5'- CCTGGAAACGAGATGCCAGG -3'
(R):5'- AGAAACCAGGGGTCTTTAAACTC -3'
Posted On2014-10-30