Incidental Mutation 'R0278:Lin9'
ID24440
Institutional Source Beutler Lab
Gene Symbol Lin9
Ensembl Gene ENSMUSG00000058729
Gene Namelin-9 homolog (C. elegans)
Synonyms2700022J23Rik
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180641150-180690694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180665923 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 198 (I198T)
Ref Sequence ENSEMBL: ENSMUSP00000141503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably damaging
Transcript: ENSMUST00000085803
AA Change: I222T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: I222T

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085804
SMART Domains Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191744
Predicted Effect probably damaging
Transcript: ENSMUST00000192561
AA Change: I238T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: I238T

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192725
AA Change: I198T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: I198T

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193892
AA Change: I222T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729
AA Change: I222T

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194638
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Lin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Lin9 APN 1 180667367 missense probably damaging 1.00
IGL02221:Lin9 APN 1 180650834 missense probably benign 0.03
IGL02233:Lin9 APN 1 180689300 missense probably damaging 0.98
IGL02370:Lin9 APN 1 180688018 missense probably damaging 1.00
IGL02794:Lin9 APN 1 180651879 missense probably damaging 1.00
R1488:Lin9 UTSW 1 180688285 missense possibly damaging 0.61
R3808:Lin9 UTSW 1 180659111 missense probably null 0.32
R3809:Lin9 UTSW 1 180659111 missense probably null 0.32
R3884:Lin9 UTSW 1 180688065 nonsense probably null
R3978:Lin9 UTSW 1 180668792 missense possibly damaging 0.94
R4600:Lin9 UTSW 1 180681194 missense probably damaging 0.99
R4625:Lin9 UTSW 1 180689280 missense probably damaging 0.99
R4730:Lin9 UTSW 1 180665851 nonsense probably null
R4987:Lin9 UTSW 1 180668764 missense probably damaging 1.00
R5034:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5035:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5045:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5046:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5148:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5180:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5181:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5221:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5222:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5329:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5332:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5633:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5634:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5696:Lin9 UTSW 1 180659081 missense probably benign 0.00
R5812:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5813:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5814:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5851:Lin9 UTSW 1 180669198 missense probably benign 0.01
R7046:Lin9 UTSW 1 180667370 missense probably damaging 1.00
R7084:Lin9 UTSW 1 180688096 missense probably benign 0.11
R8163:Lin9 UTSW 1 180659126 missense probably damaging 1.00
R8421:Lin9 UTSW 1 180665800 missense probably damaging 1.00
R8776:Lin9 UTSW 1 180668885 critical splice donor site probably null
R8776-TAIL:Lin9 UTSW 1 180668885 critical splice donor site probably null
Z1177:Lin9 UTSW 1 180650802 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTAATGTTAGCCTGGCCTGGCTTAG -3'
(R):5'- AACTCCAGTCTGAAGGGACAGCATA -3'

Sequencing Primer
(F):5'- AAGCGGCAGAAAATCAGGCT -3'
(R):5'- gcctttgccactttgcc -3'
Posted On2013-04-16