Incidental Mutation 'R2301:Lyn'
ID244416
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene NameLYN proto-oncogene, Src family tyrosine kinase
SynonymsHck-2
MMRRC Submission 040300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2301 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location3678115-3813122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3780959 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 345 (R345H)
Ref Sequence ENSEMBL: ENSMUSP00000100075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]
Predicted Effect probably damaging
Transcript: ENSMUST00000041377
AA Change: R366H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: R366H

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103010
AA Change: R345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: R345H

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137943
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Catsper1 A G 19: 5,340,398 K602E probably benign Het
Chst13 A T 6: 90,318,289 S47R probably damaging Het
Clrn1 T G 3: 58,846,352 Y196S probably damaging Het
Csmd3 A G 15: 47,731,998 S2022P probably damaging Het
Dnhd1 T A 7: 105,705,399 F3123I probably damaging Het
Dpp9 C T 17: 56,194,973 E532K probably benign Het
Eif4g3 T A 4: 138,172,659 D970E probably damaging Het
Fam222b T C 11: 78,154,543 V310A probably damaging Het
Gm16380 A G 9: 53,884,200 noncoding transcript Het
Gtf2a1l G T 17: 88,711,472 R328L probably benign Het
Hectd4 T A 5: 121,353,537 F3679L probably benign Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Klf10 A G 15: 38,297,082 V223A possibly damaging Het
Med13l T A 5: 118,593,447 C63S probably damaging Het
Nlrp1a T C 11: 71,106,101 T960A possibly damaging Het
Ogfod1 C T 8: 94,037,368 S27L probably damaging Het
Olfr1301 T A 2: 111,754,276 V9E probably benign Het
Pcdha1 A G 18: 37,156,183 Y864C probably damaging Het
Pkd1 A G 17: 24,574,612 K1758E probably benign Het
Polk T C 13: 96,484,144 E516G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sptbn2 G A 19: 4,734,138 R636Q probably benign Het
Tmem139 G T 6: 42,263,430 C57F possibly damaging Het
Traf5 T C 1: 191,997,965 N375S probably benign Het
Tti2 T C 8: 31,155,795 V379A probably benign Het
Zfp106 T C 2: 120,535,650 E92G probably benign Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Friede UTSW 4 3789834 nonsense probably null
Kohlrabi UTSW 4 3783089 missense possibly damaging 0.74
lechuga UTSW 4 3783050 missense probably damaging 1.00
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
R1615_Lyn_036 UTSW 4 3748765 missense probably benign 0.11
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0582:Lyn UTSW 4 3743296 missense probably damaging 1.00
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3702:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
R7940:Lyn UTSW 4 3783089 missense possibly damaging 0.74
R8169:Lyn UTSW 4 3783050 missense probably damaging 1.00
R8341:Lyn UTSW 4 3743304 critical splice donor site probably null
R8782:Lyn UTSW 4 3783055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAGGGTGACTTTAGCACTATC -3'
(R):5'- AACACTTGGTGGAATTGGGG -3'

Sequencing Primer
(F):5'- TGATGGCCAACCATGACA -3'
(R):5'- TCAGGCACGGGGGTCAAAG -3'
Posted On2014-10-30