Incidental Mutation 'R2301:Gtf2a1l'
ID244438
Institutional Source Beutler Lab
Gene Symbol Gtf2a1l
Ensembl Gene ENSMUSG00000024154
Gene Namegeneral transcription factor IIA, 1-like
SynonymsGtf2a1lf, 1700011N16Rik, Alf
MMRRC Submission 040300-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R2301 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location88668660-88715152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88711472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 328 (R328L)
Ref Sequence ENSEMBL: ENSMUSP00000024970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024970]
Predicted Effect probably benign
Transcript: ENSMUST00000024970
AA Change: R328L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: R328L

DomainStartEndE-ValueType
TFIIA 9 468 6.87e-202 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Catsper1 A G 19: 5,340,398 K602E probably benign Het
Chst13 A T 6: 90,318,289 S47R probably damaging Het
Clrn1 T G 3: 58,846,352 Y196S probably damaging Het
Csmd3 A G 15: 47,731,998 S2022P probably damaging Het
Dnhd1 T A 7: 105,705,399 F3123I probably damaging Het
Dpp9 C T 17: 56,194,973 E532K probably benign Het
Eif4g3 T A 4: 138,172,659 D970E probably damaging Het
Fam222b T C 11: 78,154,543 V310A probably damaging Het
Gm16380 A G 9: 53,884,200 noncoding transcript Het
Hectd4 T A 5: 121,353,537 F3679L probably benign Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Klf10 A G 15: 38,297,082 V223A possibly damaging Het
Lyn G A 4: 3,780,959 R345H probably damaging Het
Med13l T A 5: 118,593,447 C63S probably damaging Het
Nlrp1a T C 11: 71,106,101 T960A possibly damaging Het
Ogfod1 C T 8: 94,037,368 S27L probably damaging Het
Olfr1301 T A 2: 111,754,276 V9E probably benign Het
Pcdha1 A G 18: 37,156,183 Y864C probably damaging Het
Pkd1 A G 17: 24,574,612 K1758E probably benign Het
Polk T C 13: 96,484,144 E516G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sptbn2 G A 19: 4,734,138 R636Q probably benign Het
Tmem139 G T 6: 42,263,430 C57F possibly damaging Het
Traf5 T C 1: 191,997,965 N375S probably benign Het
Tti2 T C 8: 31,155,795 V379A probably benign Het
Zfp106 T C 2: 120,535,650 E92G probably benign Het
Other mutations in Gtf2a1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gtf2a1l APN 17 88694295 missense probably damaging 1.00
IGL00928:Gtf2a1l APN 17 88694462 missense probably benign 0.09
IGL00974:Gtf2a1l APN 17 88714949 missense probably damaging 1.00
IGL01024:Gtf2a1l APN 17 88671291 missense probably damaging 1.00
IGL02429:Gtf2a1l APN 17 88668713 start codon destroyed probably null 0.61
IGL02658:Gtf2a1l APN 17 88668718 missense probably benign 0.01
IGL03377:Gtf2a1l APN 17 88711593 missense probably benign 0.03
R0848:Gtf2a1l UTSW 17 88694229 missense probably damaging 0.99
R0899:Gtf2a1l UTSW 17 88668724 missense possibly damaging 0.56
R1435:Gtf2a1l UTSW 17 88694315 missense probably damaging 1.00
R1716:Gtf2a1l UTSW 17 88694580 missense probably benign 0.06
R1861:Gtf2a1l UTSW 17 88714954 missense probably damaging 1.00
R2906:Gtf2a1l UTSW 17 88694655 missense possibly damaging 0.92
R4281:Gtf2a1l UTSW 17 88711637 missense possibly damaging 0.95
R4289:Gtf2a1l UTSW 17 88694456 missense probably damaging 0.98
R4771:Gtf2a1l UTSW 17 88690020 missense probably benign 0.23
R4904:Gtf2a1l UTSW 17 88690043 critical splice donor site probably null
R4941:Gtf2a1l UTSW 17 88714922 missense probably damaging 1.00
R5106:Gtf2a1l UTSW 17 88694645 missense possibly damaging 0.95
R6003:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6128:Gtf2a1l UTSW 17 88694658 missense probably null 0.94
R6246:Gtf2a1l UTSW 17 88671547 missense probably benign 0.09
R6481:Gtf2a1l UTSW 17 88711625 missense probably benign 0.09
R7344:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R7462:Gtf2a1l UTSW 17 88694138 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGGCAGGGAGCTCATTTG -3'
(R):5'- TCATTCGATACGCTGTCCAC -3'

Sequencing Primer
(F):5'- CCCAGAATTTCACATTAAGAGACTG -3'
(R):5'- GATACGCTGTCCACTTCTTCAAG -3'
Posted On2014-10-30