Mutagenetix > Incidental Mutation

Incidental Mutation 'R2301:Sptbn2'

244440

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

040300-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2301 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4761195-4802388 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 4784166 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 636 (R636Q)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991]

AlphaFold

Q68FG2

Predicted Effect

probably benign
Transcript: ENSMUST00000008991
AA Change: R636Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R636Q

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Catsper1	A	G	19: 5,390,426 (GRCm39)	K602E	probably benign	Het
Chst13	A	T	6: 90,295,271 (GRCm39)	S47R	probably damaging	Het
Clrn1	T	G	3: 58,753,773 (GRCm39)	Y196S	probably damaging	Het
Csmd3	A	G	15: 47,595,394 (GRCm39)	S2022P	probably damaging	Het
Dnhd1	T	A	7: 105,354,606 (GRCm39)	F3123I	probably damaging	Het
Dpp9	C	T	17: 56,501,973 (GRCm39)	E532K	probably benign	Het
Eif4g3	T	A	4: 137,899,970 (GRCm39)	D970E	probably damaging	Het
Fam222b	T	C	11: 78,045,369 (GRCm39)	V310A	probably damaging	Het
Gm16380	A	G	9: 53,791,484 (GRCm39)		noncoding transcript	Het
Gtf2a1l	G	T	17: 89,018,900 (GRCm39)	R328L	probably benign	Het
Hectd4	T	A	5: 121,491,600 (GRCm39)	F3679L	probably benign	Het
Itgb8	T	C	12: 119,166,190 (GRCm39)	I114V	probably benign	Het
Klf10	A	G	15: 38,297,326 (GRCm39)	V223A	possibly damaging	Het
Lyn	G	A	4: 3,780,959 (GRCm39)	R345H	probably damaging	Het
Med13l	T	A	5: 118,731,512 (GRCm39)	C63S	probably damaging	Het
Nlrp1a	T	C	11: 70,996,927 (GRCm39)	T960A	possibly damaging	Het
Ogfod1	C	T	8: 94,763,996 (GRCm39)	S27L	probably damaging	Het
Or4k51	T	A	2: 111,584,621 (GRCm39)	V9E	probably benign	Het
Pcdha1	A	G	18: 37,289,236 (GRCm39)	Y864C	probably damaging	Het
Pkd1	A	G	17: 24,793,586 (GRCm39)	K1758E	probably benign	Het
Polk	T	C	13: 96,620,652 (GRCm39)	E516G	probably benign	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Slco5a1	C	T	1: 12,949,486 (GRCm39)	G635S	probably damaging	Het
Tmem139	G	T	6: 42,240,364 (GRCm39)	C57F	possibly damaging	Het
Traf5	T	C	1: 191,729,926 (GRCm39)	N375S	probably benign	Het
Tti2	T	C	8: 31,645,823 (GRCm39)	V379A	probably benign	Het
Zfp106	T	C	2: 120,366,131 (GRCm39)	E92G	probably benign	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4,774,733 (GRCm39)	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4,775,966 (GRCm39)	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01373:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01420:Sptbn2	APN	19	4,784,153 (GRCm39)	missense	probably benign
IGL01456:Sptbn2	APN	19	4,796,777 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4,799,721 (GRCm39)	missense	probably benign
IGL03026:Sptbn2	APN	19	4,774,261 (GRCm39)	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4,782,689 (GRCm39)	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4,797,860 (GRCm39)	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4,795,605 (GRCm39)	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0121:Sptbn2	UTSW	19	4,795,321 (GRCm39)	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4,774,772 (GRCm39)	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4,796,970 (GRCm39)	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4,795,173 (GRCm39)	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4,787,954 (GRCm39)	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4,795,966 (GRCm39)	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4,776,718 (GRCm39)	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4,790,014 (GRCm39)	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4,798,151 (GRCm39)	nonsense	probably null
R0742:Sptbn2	UTSW	19	4,769,011 (GRCm39)	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4,782,693 (GRCm39)	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4,769,004 (GRCm39)	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4,794,274 (GRCm39)	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4,800,270 (GRCm39)	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4,800,525 (GRCm39)	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4,795,992 (GRCm39)	nonsense	probably null
R1820:Sptbn2	UTSW	19	4,776,624 (GRCm39)	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4,782,569 (GRCm39)	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4,782,713 (GRCm39)	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4,795,327 (GRCm39)	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4,788,587 (GRCm39)	missense	probably benign	0.09
R2310:Sptbn2	UTSW	19	4,768,963 (GRCm39)	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4,798,664 (GRCm39)	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4,795,950 (GRCm39)	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4,788,383 (GRCm39)	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4,782,630 (GRCm39)	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4,789,267 (GRCm39)	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4,792,508 (GRCm39)	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4,798,182 (GRCm39)	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4,779,458 (GRCm39)	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4,788,497 (GRCm39)	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4,779,337 (GRCm39)	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4,779,230 (GRCm39)	splice site	probably null
R4981:Sptbn2	UTSW	19	4,801,686 (GRCm39)	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4,787,885 (GRCm39)	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4,774,212 (GRCm39)	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4,800,110 (GRCm39)	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4,768,936 (GRCm39)	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4,800,133 (GRCm39)	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4,775,978 (GRCm39)	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4,798,975 (GRCm39)	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4,774,695 (GRCm39)	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4,788,247 (GRCm39)	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4,789,306 (GRCm39)	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4,781,420 (GRCm39)	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4,798,166 (GRCm39)	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4,774,674 (GRCm39)	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4,792,446 (GRCm39)	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4,794,208 (GRCm39)	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4,797,954 (GRCm39)	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4,799,843 (GRCm39)	missense	probably benign
R6703:Sptbn2	UTSW	19	4,799,842 (GRCm39)	missense	probably benign
R6753:Sptbn2	UTSW	19	4,797,813 (GRCm39)	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4,794,173 (GRCm39)	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4,799,488 (GRCm39)	missense	probably null
R7219:Sptbn2	UTSW	19	4,774,201 (GRCm39)	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4,787,471 (GRCm39)	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4,801,602 (GRCm39)	missense	probably benign
R7469:Sptbn2	UTSW	19	4,795,146 (GRCm39)	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4,798,110 (GRCm39)	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4,776,196 (GRCm39)	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4,794,235 (GRCm39)	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4,774,153 (GRCm39)	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4,784,171 (GRCm39)	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4,794,290 (GRCm39)	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4,796,827 (GRCm39)	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4,787,431 (GRCm39)	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4,779,158 (GRCm39)	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4,796,724 (GRCm39)	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4,784,241 (GRCm39)	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4,789,974 (GRCm39)	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4,788,218 (GRCm39)	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4,795,341 (GRCm39)	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4,795,219 (GRCm39)	missense	probably benign	0.01
Z1176:Sptbn2	UTSW	19	4,788,233 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGAGTCCTACCACAGTGAG -3'
(R):5'- CTAACTGCTGACCTTGCTCCAG -3'

Sequencing Primer
(F):5'- TCCTACCACAGTGAGCTGGG -3'
(R):5'- CTTGCTCCAGGGTGAGCTTC -3'

Posted On

2014-10-30