Incidental Mutation 'R2302:Slco5a1'
ID244442
Institutional Source Beutler Lab
Gene Symbol Slco5a1
Ensembl Gene ENSMUSG00000025938
Gene Namesolute carrier organic anion transporter family, member 5A1
SynonymsA630033C23Rik
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12866549-12992650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12879262 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 635 (G635S)
Ref Sequence ENSEMBL: ENSMUSP00000111061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]
Predicted Effect probably damaging
Transcript: ENSMUST00000115402
AA Change: G635S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: G635S

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115403
AA Change: G635S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: G635S

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 547 2.8e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133201
Predicted Effect probably benign
Transcript: ENSMUST00000136197
SMART Domains Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3.6e-27 PFAM
KAZAL 559 601 4.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146763
SMART Domains Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 352 8.4e-72 PFAM
Pfam:MFS_1 137 332 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147606
SMART Domains Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 478 1.5e-105 PFAM
Pfam:MFS_1 137 476 2.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188454
AA Change: G635S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: G635S

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 4.1e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Meta Mutation Damage Score 0.3238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Slco5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Slco5a1 APN 1 12871995 missense probably benign 0.01
IGL02330:Slco5a1 APN 1 12939060 missense probably damaging 1.00
IGL02660:Slco5a1 APN 1 12989636 missense probably damaging 1.00
IGL02904:Slco5a1 APN 1 12921097 missense probably damaging 0.98
IGL02972:Slco5a1 APN 1 12990155 nonsense probably null
IGL03100:Slco5a1 APN 1 12879280 missense possibly damaging 0.67
IGL03270:Slco5a1 APN 1 12872028 missense probably benign
R0969:Slco5a1 UTSW 1 12989892 missense probably damaging 1.00
R1337:Slco5a1 UTSW 1 12939142 missense probably benign 0.01
R1434:Slco5a1 UTSW 1 12871908 missense probably benign 0.00
R1627:Slco5a1 UTSW 1 12990383 missense probably damaging 1.00
R1767:Slco5a1 UTSW 1 12989615 missense probably damaging 1.00
R1893:Slco5a1 UTSW 1 12894472 missense probably damaging 1.00
R1894:Slco5a1 UTSW 1 12872259 missense probably damaging 1.00
R2301:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2303:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2304:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2349:Slco5a1 UTSW 1 12921152 missense probably damaging 1.00
R2351:Slco5a1 UTSW 1 12989934 missense probably benign 0.05
R3079:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R3949:Slco5a1 UTSW 1 12989609 missense probably damaging 1.00
R4197:Slco5a1 UTSW 1 12894516 missense probably damaging 1.00
R4380:Slco5a1 UTSW 1 12939168 missense probably damaging 0.96
R4532:Slco5a1 UTSW 1 12879223 missense probably damaging 1.00
R4750:Slco5a1 UTSW 1 12879280 missense probably damaging 1.00
R5891:Slco5a1 UTSW 1 12990402 missense probably benign 0.04
R6024:Slco5a1 UTSW 1 12944070 missense probably damaging 1.00
R6332:Slco5a1 UTSW 1 12921185 missense probably benign 0.27
R6492:Slco5a1 UTSW 1 12989927 missense probably damaging 1.00
R6860:Slco5a1 UTSW 1 12881196 intron probably benign
R6994:Slco5a1 UTSW 1 12881393 missense probably damaging 1.00
R7121:Slco5a1 UTSW 1 12990437 missense probably benign 0.00
R7747:Slco5a1 UTSW 1 12990122 missense probably benign 0.05
R7802:Slco5a1 UTSW 1 12990476 missense possibly damaging 0.76
R7895:Slco5a1 UTSW 1 12989703 missense possibly damaging 0.52
R7984:Slco5a1 UTSW 1 12881384 missense probably damaging 1.00
R8172:Slco5a1 UTSW 1 12990266 nonsense probably null
RF010:Slco5a1 UTSW 1 12871947 missense probably damaging 1.00
X0065:Slco5a1 UTSW 1 12872212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAGAAGAGCACGTATG -3'
(R):5'- GCCAGGCTTTATTCTTGACTG -3'

Sequencing Primer
(F):5'- ACGTATGGGTGCCTGCCAG -3'
(R):5'- GGCTTTATTCTTGACTGGCCTATAAC -3'
Posted On2014-10-30