Mutagenetix > Incidental Mutations

Incidental Mutation 'R2302:Agpat2'

244443

Institutional Source

Beutler Lab

Gene Symbol

Agpat2

Ensembl Gene

ENSMUSG00000026922

Gene Name

1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)

Synonyms

BSCL1, 2510002J07Rik, LPAAT-beta

MMRRC Submission

040301-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R2302 (G1)

Quality Score

104

Status

Validated

Chromosome

Chromosomal Location

26593057-26604417 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26604195 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 6 (W6R)

Ref Sequence

ENSEMBL: ENSMUSP00000028286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000154753] [ENSMUST00000174066]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028286
AA Change: W6R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922
AA Change: W6R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	28	50	N/A	INTRINSIC
PlsC	92	207	5.17e-40	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131940

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140508

Predicted Effect

probably benign
Transcript: ENSMUST00000154753

SMART Domains

Protein: ENSMUSP00000115059
Gene: ENSMUSG00000026922

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:Acyltransferase	92	129	1.8e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174066

SMART Domains

Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	64	88	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of white and brown adipose tissue, insulin resistance, and hepatic steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahrr	C	A	13: 74,277,661	V72F	probably damaging	Het
Ank1	G	A	8: 23,119,399	C1369Y	probably damaging	Het
Cdh3	C	A	8: 106,545,069	P538Q	probably damaging	Het
Cnn2	C	G	10: 79,991,399	R35G	possibly damaging	Het
Csmd3	C	A	15: 48,314,051	A364S	probably benign	Het
Dhcr7	A	G	7: 143,837,892	T73A	probably benign	Het
Gbp9	T	C	5: 105,094,092	N200D	possibly damaging	Het
Hyls1	T	C	9: 35,564,069	E3G	possibly damaging	Het
Ifngr1	T	C	10: 19,609,645	L464P	probably damaging	Het
Kdm1b	TCATTGTCC	TCATTGTCCATTGTCC	13: 47,064,088		probably null	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lhfpl2	T	C	13: 94,174,546	V108A	probably benign	Het
Lrrc7	C	G	3: 158,135,244	G1386R	probably damaging	Het
Mlc1	A	G	15: 88,965,437	V231A	possibly damaging	Het
Mup4	T	A	4: 59,960,702		probably null	Het
Myh8	A	T	11: 67,286,239	R406W	probably damaging	Het
Poldip3	T	C	15: 83,129,268		probably benign	Het
Pomt1	G	A	2: 32,243,659	G216S	probably benign	Het
Ppil6	T	A	10: 41,501,799	C169S	probably damaging	Het
Prokr2	A	G	2: 132,381,184	I146T	probably damaging	Het
Rab3b	T	C	4: 108,929,443	V130A	probably damaging	Het
Reck	T	A	4: 43,931,015	I672N	probably benign	Het
Scn1a	T	C	2: 66,277,745	T1546A	probably damaging	Het
Sftpd	T	A	14: 41,172,442	E340V	probably damaging	Het
Slco5a1	C	T	1: 12,879,262	G635S	probably damaging	Het
Slfn10-ps	A	T	11: 83,028,930		noncoding transcript	Het
Svopl	A	T	6: 38,041,166		probably benign	Het
Tbx5	A	G	5: 119,841,859	K157E	probably damaging	Het
Ttn	A	T	2: 76,894,352	C6333S	probably benign	Het
Zfp609	T	C	9: 65,794,897	K158E	possibly damaging	Het
Zscan20	T	C	4: 128,588,264	N535S	probably damaging	Het

Other mutations in Agpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03412:Agpat2	APN	2	26593661	missense	probably benign	0.02
R2849:Agpat2	UTSW	2	26597239	missense	probably damaging	1.00
R5151:Agpat2	UTSW	2	26597206	missense	probably damaging	1.00
R6378:Agpat2	UTSW	2	26596135	missense	probably benign	0.05
R8078:Agpat2	UTSW	2	26604101	missense	possibly damaging	0.95
R8425:Agpat2	UTSW	2	26593654	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCCTCATGTTATCCACGGTG -3'
(R):5'- TAGGTCGGTTGCACACCCTTAG -3'

Sequencing Primer
(F):5'- TGTTATCCACGGTGCGGCC -3'
(R):5'- TCAATGTCCTGCCGCAAG -3'

Posted On

2014-10-30