Incidental Mutation 'R2302:Agpat2'
ID244443
Institutional Source Beutler Lab
Gene Symbol Agpat2
Ensembl Gene ENSMUSG00000026922
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
SynonymsBSCL1, 2510002J07Rik, LPAAT-beta
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.673) question?
Stock #R2302 (G1)
Quality Score104
Status Validated
Chromosome2
Chromosomal Location26593057-26604417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26604195 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 6 (W6R)
Ref Sequence ENSEMBL: ENSMUSP00000028286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000154753] [ENSMUST00000174066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028286
AA Change: W6R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922
AA Change: W6R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
PlsC 92 207 5.17e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140508
Predicted Effect probably benign
Transcript: ENSMUST00000154753
SMART Domains Protein: ENSMUSP00000115059
Gene: ENSMUSG00000026922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Acyltransferase 92 129 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of white and brown adipose tissue, insulin resistance, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Agpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03412:Agpat2 APN 2 26593661 missense probably benign 0.02
R2849:Agpat2 UTSW 2 26597239 missense probably damaging 1.00
R5151:Agpat2 UTSW 2 26597206 missense probably damaging 1.00
R6378:Agpat2 UTSW 2 26596135 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCTCATGTTATCCACGGTG -3'
(R):5'- TAGGTCGGTTGCACACCCTTAG -3'

Sequencing Primer
(F):5'- TGTTATCCACGGTGCGGCC -3'
(R):5'- TCAATGTCCTGCCGCAAG -3'
Posted On2014-10-30