Incidental Mutation 'R2302:Rab3b'
ID244451
Institutional Source Beutler Lab
Gene Symbol Rab3b
Ensembl Gene ENSMUSG00000003411
Gene NameRAB3B, member RAS oncogene family
Synonyms
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108879063-108943324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108929443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000102261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003502] [ENSMUST00000106650] [ENSMUST00000106651]
Predicted Effect probably damaging
Transcript: ENSMUST00000003502
AA Change: V130A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003502
Gene: ENSMUSG00000003411
AA Change: V130A

DomainStartEndE-ValueType
RAB 23 186 1.86e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106650
AA Change: V130A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102261
Gene: ENSMUSG00000003411
AA Change: V130A

DomainStartEndE-ValueType
RAB 23 186 1.86e-96 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106651
AA Change: V130A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102262
Gene: ENSMUSG00000003411
AA Change: V130A

DomainStartEndE-ValueType
RAB 23 195 4.88e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119330
Meta Mutation Damage Score 0.2213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable with no apparent decrease in weight or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Rab3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Rab3b APN 4 108940802 missense probably damaging 1.00
IGL01612:Rab3b APN 4 108924026 critical splice donor site probably null
IGL01636:Rab3b APN 4 108940719 missense possibly damaging 0.55
IGL01777:Rab3b APN 4 108929410 missense probably damaging 1.00
R0601:Rab3b UTSW 4 108890389 missense probably damaging 1.00
R1884:Rab3b UTSW 4 108929452 missense probably damaging 1.00
R2312:Rab3b UTSW 4 108890494 missense probably damaging 1.00
R8744:Rab3b UTSW 4 108923987 missense probably damaging 0.99
R8893:Rab3b UTSW 4 108940728 missense probably benign 0.19
X0024:Rab3b UTSW 4 108890308 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- AGAAGGGCTCTGATTCTAGGATGG -3'
(R):5'- GTCACAAATAAAACCTCACTCTTAGGG -3'

Sequencing Primer
(F):5'- GTGGTAGCCATGTCATGCC -3'
(R):5'- CTATAGAGTGAGTTCCAGGTCAGCC -3'
Posted On2014-10-30