Incidental Mutation 'R2302:Tbx5'
ID244455
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119841859 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 157 (K157E)
Ref Sequence ENSEMBL: ENSMUSP00000143828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]
Predicted Effect probably damaging
Transcript: ENSMUST00000018407
AA Change: K157E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: K157E

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202504
AA Change: K157E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263
AA Change: K157E

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 218 6.3e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202723
SMART Domains Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 120 3.1e-9 SMART
Meta Mutation Damage Score 0.9350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119845113 unclassified probably null
R2011:Tbx5 UTSW 5 119841906 splice site probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6218:Tbx5 UTSW 5 119853598 missense probably damaging 1.00
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6700:Tbx5 UTSW 5 119871397 missense probably benign 0.30
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R7801:Tbx5 UTSW 5 119836999 missense probably benign 0.44
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCAGCTCTCTTCTGACCAG -3'
(R):5'- ACAACTTCAGCCTTGAGGG -3'

Sequencing Primer
(F):5'- TCTGACCAGCTACCTCCAGG -3'
(R):5'- GGTGGGTCCCAATTAGCTG -3'
Posted On2014-10-30