Incidental Mutation 'R2302:Svopl'
ID244456
Institutional Source Beutler Lab
Gene Symbol Svopl
Ensembl Gene ENSMUSG00000029830
Gene NameSV2 related protein homolog (rat)-like
Synonyms9430071P14Rik
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37983739-38046996 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 38041166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096040]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040486
Predicted Effect probably benign
Transcript: ENSMUST00000096040
SMART Domains Protein: ENSMUSP00000093743
Gene: ENSMUSG00000029830

DomainStartEndE-ValueType
Pfam:Sugar_tr 17 297 5.5e-20 PFAM
Pfam:MFS_1 50 308 2.1e-20 PFAM
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 384 406 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a member of solute carrier family 22, which includes transmembrane proteins that transport toxins and drugs from the body. This gene is a paralog of the SVOP gene that encodes synaptic vesicle 2-related protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Svopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Svopl APN 6 38031017 critical splice donor site probably null
IGL01531:Svopl APN 6 38026941 splice site probably benign
IGL02161:Svopl APN 6 38036815 splice site probably benign
IGL02554:Svopl APN 6 38017043 missense probably damaging 0.99
IGL03249:Svopl APN 6 38017053 missense probably benign 0.05
PIT4434001:Svopl UTSW 6 38014866 missense possibly damaging 0.85
R0285:Svopl UTSW 6 37984522 missense probably benign 0.02
R0423:Svopl UTSW 6 38036707 splice site probably benign
R0692:Svopl UTSW 6 38017196 missense probably damaging 1.00
R0960:Svopl UTSW 6 38017057 nonsense probably null
R1163:Svopl UTSW 6 38029700 missense possibly damaging 0.89
R1526:Svopl UTSW 6 38029635 missense probably benign 0.03
R2295:Svopl UTSW 6 38019733 missense possibly damaging 0.52
R5933:Svopl UTSW 6 38017014 splice site probably benign
R6367:Svopl UTSW 6 38019679 missense possibly damaging 0.88
R6595:Svopl UTSW 6 38041067 splice site probably null
R6903:Svopl UTSW 6 38021608 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCACTGCAAAGGCTGATG -3'
(R):5'- AATGCCAGCTTTCAAACTAGTG -3'

Sequencing Primer
(F):5'- ATTCCTACTCCCGGGAATGG -3'
(R):5'- GTACAGAGGTACCTGTCTGTAATCC -3'
Posted On2014-10-30