Incidental Mutation 'R2302:Dhcr7'
ID244457
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143837892 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 73 (T73A)
Ref Sequence ENSEMBL: ENSMUSP00000119984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably benign
Transcript: ENSMUST00000073878
AA Change: T73A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: T73A

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124340
AA Change: T73A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: T73A

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably benign
Transcript: ENSMUST00000141916
AA Change: T73A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: T73A

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
AA Change: T73A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: T73A

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144034
AA Change: T73A
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454
AA Change: T73A

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably benign
Transcript: ENSMUST00000207143
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143845490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAGAAGAGGGTCTCTAAGTCC -3'
(R):5'- TGTAACTGCTGCACCCTGAC -3'

Sequencing Primer
(F):5'- CCTGTGGGGCTTGAGAAC -3'
(R):5'- GACTTGAACATCACTCTGGGTCAG -3'
Posted On2014-10-30