Incidental Mutation 'R2302:Lhfpl2'
ID244470
Institutional Source Beutler Lab
Gene Symbol Lhfpl2
Ensembl Gene ENSMUSG00000045312
Gene Namelipoma HMGIC fusion partner-like 2
Synonymsvgim
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location94057796-94195409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94174546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000152241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054274] [ENSMUST00000118195] [ENSMUST00000120051] [ENSMUST00000121618] [ENSMUST00000156071] [ENSMUST00000221096] [ENSMUST00000223423]
Predicted Effect probably benign
Transcript: ENSMUST00000054274
AA Change: V108A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062239
Gene: ENSMUSG00000045312
AA Change: V108A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118195
AA Change: V108A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112655
Gene: ENSMUSG00000045312
AA Change: V108A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120051
Predicted Effect probably benign
Transcript: ENSMUST00000121618
AA Change: V108A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113468
Gene: ENSMUSG00000045312
AA Change: V108A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131595
Predicted Effect probably benign
Transcript: ENSMUST00000156071
AA Change: V108A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117113
Gene: ENSMUSG00000045312
AA Change: V108A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 139 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221096
Predicted Effect probably benign
Transcript: ENSMUST00000223423
AA Change: V108A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for a spontaneous point mutation have a completely closed vagina, soft swelling of the perineum and buildup of viscous fluid in the uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Sftpd T A 14: 41,172,442 E340V probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Lhfpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Lhfpl2 APN 13 94191911 missense probably benign 0.00
IGL02576:Lhfpl2 APN 13 94174226 start codon destroyed probably null 1.00
R0278:Lhfpl2 UTSW 13 94174435 missense probably benign 0.00
R0482:Lhfpl2 UTSW 13 94174610 missense probably damaging 1.00
R1134:Lhfpl2 UTSW 13 94174252 missense probably damaging 1.00
R2130:Lhfpl2 UTSW 13 94192049 missense possibly damaging 0.91
R2995:Lhfpl2 UTSW 13 94174458 missense probably benign 0.04
R6613:Lhfpl2 UTSW 13 94174495 missense probably damaging 1.00
R6922:Lhfpl2 UTSW 13 94174521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCGGGAAAGCCAAGAC -3'
(R):5'- CCAGCCCTCTTCAACAGATG -3'

Sequencing Primer
(F):5'- GCAGGCAGGCATGAACTC -3'
(R):5'- TCTTCAACAGATGCAAGCAGTAAGTG -3'
Posted On2014-10-30