Incidental Mutation 'R2303:Slc40a1'
ID244477
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
MMRRC Submission 040302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2303 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 45910884 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137]
Predicted Effect probably benign
Transcript: ENSMUST00000027137
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191247
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gnrhr C T 5: 86,197,749 G26D probably benign Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Sema3g T C 14: 31,222,615 F329L probably damaging Het
Setd1a G A 7: 127,799,155 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Trappc11 A G 8: 47,503,416 Y842H probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zcchc8 A G 5: 123,700,597 L626P probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2365:Slc40a1 UTSW 1 45924713 splice site probably null
R3718:Slc40a1 UTSW 1 45910991 missense probably benign
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5404:Slc40a1 UTSW 1 45912328 missense probably damaging 1.00
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
R7755:Slc40a1 UTSW 1 45911306 missense probably damaging 0.99
R8085:Slc40a1 UTSW 1 45918368 missense probably damaging 1.00
R8218:Slc40a1 UTSW 1 45910969 missense probably benign 0.03
R8308:Slc40a1 UTSW 1 45911020 missense probably benign 0.02
R8333:Slc40a1 UTSW 1 45911279 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACACAGACACACATGGAAAGGG -3'
(R):5'- TGAATGTGGAGCCAGTGTCC -3'

Sequencing Primer
(F):5'- ACTTGACATGCATGAGGTCC -3'
(R):5'- GGAGCCAGTGTCCCCAACTAC -3'
Posted On2014-10-30