Incidental Mutation 'R2303:Zcchc8'
ID 244490
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission 040302-MU
Accession Numbers

Genbank: NM_027494; MGI: 1917900

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R2303 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123698294-123721100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123700597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 626 (L626P)
Ref Sequence ENSEMBL: ENSMUSP00000142363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282]
AlphaFold Q9CYA6
Predicted Effect probably benign
Transcript: ENSMUST00000031376
AA Change: L626P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: L626P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196042
Predicted Effect probably benign
Transcript: ENSMUST00000196282
AA Change: L626P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: L626P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199875
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gnrhr C T 5: 86,197,749 G26D probably benign Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Sema3g T C 14: 31,222,615 F329L probably damaging Het
Setd1a G A 7: 127,799,155 probably benign Het
Slc40a1 G A 1: 45,910,884 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Trappc11 A G 8: 47,503,416 Y842H probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123704569 missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123720719 critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123700918 missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123719483 splice site probably benign
3-1:Zcchc8 UTSW 5 123709481 missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123700932 missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123707337 missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123717027 missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123700658 missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123700373 nonsense probably null
R2216:Zcchc8 UTSW 5 123707403 missense probably damaging 1.00
R2877:Zcchc8 UTSW 5 123700703 missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123700909 missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
R8738:Zcchc8 UTSW 5 123703007 missense probably damaging 0.99
R8791:Zcchc8 UTSW 5 123707299 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCAGTGGATTCAGCCATG -3'
(R):5'- TTAACTGGGAACTCAGTGGCC -3'

Sequencing Primer
(F):5'- CAGCCATGTTCTCAAATTCAAAGGG -3'
(R):5'- CCGTGTCCAAACGAGTTTG -3'
Posted On 2014-10-30