Incidental Mutation 'R2303:Setd1a'
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
MMRRC Submission 040302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2303 (G1)
Quality Score225
Status Validated
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 127799155 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000206674]
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: R1635Q
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: R1635Q

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: R1635Q
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: R1635Q

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106267
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806

SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: R1092Q
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Meta Mutation Damage Score 0.4288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gnrhr C T 5: 86,197,749 G26D probably benign Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Sema3g T C 14: 31,222,615 F329L probably damaging Het
Slc40a1 G A 1: 45,910,884 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Trappc11 A G 8: 47,503,416 Y842H probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zcchc8 A G 5: 123,700,597 L626P probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
RF001:Setd1a UTSW 7 127785314 unclassified probably benign
RF008:Setd1a UTSW 7 127785314 unclassified probably benign
RF011:Setd1a UTSW 7 127785343 unclassified probably benign
RF014:Setd1a UTSW 7 127785346 unclassified probably benign
RF030:Setd1a UTSW 7 127785301 unclassified probably benign
RF030:Setd1a UTSW 7 127785311 unclassified probably benign
RF031:Setd1a UTSW 7 127785311 unclassified probably benign
RF036:Setd1a UTSW 7 127785300 unclassified probably benign
RF041:Setd1a UTSW 7 127785332 unclassified probably benign
RF052:Setd1a UTSW 7 127785357 unclassified probably benign
RF055:Setd1a UTSW 7 127785299 unclassified probably benign
RF056:Setd1a UTSW 7 127785303 unclassified probably benign
RF056:Setd1a UTSW 7 127785328 unclassified probably benign
RF058:Setd1a UTSW 7 127785318 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-30