Incidental Mutation 'R2304:Olfr1135'
ID244516
Institutional Source Beutler Lab
Gene Symbol Olfr1135
Ensembl Gene ENSMUSG00000075153
Gene Nameolfactory receptor 1135
SynonymsMOR177-2, GA_x6K02T2Q125-49177531-49176599
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87669835-87673664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87671894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 158 (I158L)
Ref Sequence ENSEMBL: ENSMUSP00000150079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099853] [ENSMUST00000213835]
Predicted Effect probably benign
Transcript: ENSMUST00000099853
AA Change: I158L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097439
Gene: ENSMUSG00000075153
AA Change: I158L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-44 PFAM
Pfam:7tm_1 41 290 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213835
AA Change: I158L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Olfr1135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Olfr1135 APN 2 87671815 missense probably damaging 0.99
IGL03158:Olfr1135 APN 2 87671791 missense probably benign 0.14
R0559:Olfr1135 UTSW 2 87671900 missense possibly damaging 0.54
R1288:Olfr1135 UTSW 2 87671572 missense probably benign 0.01
R2278:Olfr1135 UTSW 2 87671945 missense possibly damaging 0.63
R4328:Olfr1135 UTSW 2 87671664 missense possibly damaging 0.52
R5094:Olfr1135 UTSW 2 87671830 missense possibly damaging 0.90
R6922:Olfr1135 UTSW 2 87671453 nonsense probably null
R7042:Olfr1135 UTSW 2 87671591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAGTAGGAGACCAGGACTC -3'
(R):5'- ACTGCAGTTGGACCAAAGATG -3'

Sequencing Primer
(F):5'- AGGACTCCTGAGATGGTGCTC -3'
(R):5'- TTGGACCAAAGATGCTAGTTGACC -3'
Posted On2014-10-30