Incidental Mutation 'R2304:Dcdc5'
ID244517
Institutional Source Beutler Lab
Gene Symbol Dcdc5
Ensembl Gene ENSMUSG00000074981
Gene Namedoublecortin domain containing 5
SynonymsEG436559, 4732421G10Rik
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location106003336-106406151 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to A at 106336143 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152776
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Dcdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0544:Dcdc5 UTSW 2 106351564 exon noncoding transcript
R0563:Dcdc5 UTSW 2 106349690 exon noncoding transcript
R1456:Dcdc5 UTSW 2 106351565 exon noncoding transcript
R1476:Dcdc5 UTSW 2 106358632 exon noncoding transcript
R1521:Dcdc5 UTSW 2 106351669 critical splice donor site noncoding transcript
R1555:Dcdc5 UTSW 2 106384135 exon noncoding transcript
R2280:Dcdc5 UTSW 2 106372522 critical splice donor site noncoding transcript
R3775:Dcdc5 UTSW 2 106372393 exon noncoding transcript
R4820:Dcdc5 UTSW 2 106336075 exon noncoding transcript
R4874:Dcdc5 UTSW 2 106368106 exon noncoding transcript
R4910:Dcdc5 UTSW 2 106365550 exon noncoding transcript
R5285:Dcdc5 UTSW 2 106368155 exon noncoding transcript
R5583:Dcdc5 UTSW 2 106365433 exon noncoding transcript
R5634:Dcdc5 UTSW 2 106403980 exon noncoding transcript
R6313:Dcdc5 UTSW 2 106368171 critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTGACTGGCCAGTAGAAGG -3'
(R):5'- AGAGCTGTTTACACTTCCACTC -3'

Sequencing Primer
(F):5'- GGTCTATTGGACACAAACAGCTCTC -3'
(R):5'- CAGAAGAGATCAATTTAAGGACCTG -3'
Posted On2014-10-30