Incidental Mutation 'R2304:Rbl1'
ID244518
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene NameRB transcriptional corepressor like 1
Synonymsp107
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157145893-157204534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157147631 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1023 (T1023A)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
Predicted Effect probably benign
Transcript: ENSMUST00000029170
AA Change: T1023A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: T1023A

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0173:Rbl1 UTSW 2 157159685 missense probably benign 0.00
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1445:Rbl1 UTSW 2 157193098 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1666:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1680:Rbl1 UTSW 2 157174783 missense probably damaging 0.97
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
R7090:Rbl1 UTSW 2 157152900 missense probably benign 0.02
R7176:Rbl1 UTSW 2 157188325 missense probably damaging 1.00
R7769:Rbl1 UTSW 2 157191980 missense probably benign 0.01
R8032:Rbl1 UTSW 2 157187998 nonsense probably null
R8544:Rbl1 UTSW 2 157193204 missense probably damaging 1.00
R8552:Rbl1 UTSW 2 157196254 missense probably damaging 1.00
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AATGTGAAGGATGGAGCCCC -3'
(R):5'- TGCTCCTTCTGGTCTGATTAAAACC -3'

Sequencing Primer
(F):5'- GCCCCAGCTTTCTCCAGAAC -3'
(R):5'- AGCCACCGCTGTAAGTTG -3'
Posted On2014-10-30