Incidental Mutation 'R2304:Grid2ip'
ID244522
Institutional Source Beutler Lab
Gene Symbol Grid2ip
Ensembl Gene ENSMUSG00000010825
Gene Nameglutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonymsdelphilin
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143357338-143392152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143387840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 796 (Y796H)
Ref Sequence ENSEMBL: ENSMUSP00000113443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]
Predicted Effect probably damaging
Transcript: ENSMUST00000010969
AA Change: Y789H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: Y789H

DomainStartEndE-ValueType
low complexity region 30 55 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
PDZ 97 166 9.5e-16 SMART
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 304 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
low complexity region 464 478 N/A INTRINSIC
low complexity region 536 584 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
FH2 633 1022 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110733
AA Change: Y968H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: Y968H

DomainStartEndE-ValueType
PDZ 10 80 1.13e-13 SMART
low complexity region 98 109 N/A INTRINSIC
low complexity region 209 234 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
PDZ 276 345 9.5e-16 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 463 483 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 715 763 N/A INTRINSIC
low complexity region 786 804 N/A INTRINSIC
FH2 812 1201 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120825
AA Change: Y796H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: Y796H

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
PDZ 104 173 9.5e-16 SMART
low complexity region 263 279 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 591 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
FH2 640 1029 1.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176473
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Grid2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Grid2ip APN 5 143388909 missense probably benign
IGL02894:Grid2ip APN 5 143391108 missense probably benign 0.04
R0024:Grid2ip UTSW 5 143391041 missense probably damaging 1.00
R0355:Grid2ip UTSW 5 143357897 missense probably benign 0.10
R0403:Grid2ip UTSW 5 143357620 missense possibly damaging 0.84
R0523:Grid2ip UTSW 5 143373043 missense possibly damaging 0.85
R0605:Grid2ip UTSW 5 143379362 missense probably damaging 0.99
R0664:Grid2ip UTSW 5 143363977 critical splice donor site probably null
R1116:Grid2ip UTSW 5 143382914 missense possibly damaging 0.96
R1251:Grid2ip UTSW 5 143386015 missense possibly damaging 0.69
R1381:Grid2ip UTSW 5 143362651 missense probably benign 0.00
R1384:Grid2ip UTSW 5 143386096 critical splice donor site probably null
R1477:Grid2ip UTSW 5 143375585 missense probably damaging 1.00
R2266:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2267:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2873:Grid2ip UTSW 5 143357929 missense probably benign
R2874:Grid2ip UTSW 5 143357929 missense probably benign
R3196:Grid2ip UTSW 5 143388178 missense probably damaging 0.99
R3622:Grid2ip UTSW 5 143386019 missense probably damaging 1.00
R3930:Grid2ip UTSW 5 143386039 missense probably damaging 1.00
R4628:Grid2ip UTSW 5 143382875 missense probably damaging 1.00
R4696:Grid2ip UTSW 5 143391376 intron probably benign
R4709:Grid2ip UTSW 5 143388903 missense probably damaging 1.00
R4772:Grid2ip UTSW 5 143375700 missense possibly damaging 0.91
R4838:Grid2ip UTSW 5 143388775 nonsense probably null
R4857:Grid2ip UTSW 5 143382629 missense probably damaging 1.00
R5243:Grid2ip UTSW 5 143377505 missense probably damaging 1.00
R5894:Grid2ip UTSW 5 143388911 missense probably damaging 1.00
R6014:Grid2ip UTSW 5 143387823 missense possibly damaging 0.84
R6076:Grid2ip UTSW 5 143387375 missense probably benign 0.17
R6209:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6257:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6274:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6439:Grid2ip UTSW 5 143373502 missense probably damaging 0.99
R7098:Grid2ip UTSW 5 143357591 missense probably damaging 0.97
R7405:Grid2ip UTSW 5 143380444 missense probably benign 0.03
R7652:Grid2ip UTSW 5 143382638 missense probably damaging 1.00
R8259:Grid2ip UTSW 5 143362589 missense probably benign 0.20
R8261:Grid2ip UTSW 5 143381940 critical splice donor site probably null
R8350:Grid2ip UTSW 5 143377518 missense probably damaging 1.00
R8391:Grid2ip UTSW 5 143380196 missense probably damaging 0.98
R8450:Grid2ip UTSW 5 143377518 missense probably damaging 1.00
X0010:Grid2ip UTSW 5 143357878 missense probably benign 0.01
X0012:Grid2ip UTSW 5 143362639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTTTAGGTCAAGGCAGACGC -3'
(R):5'- CCTCCCCATGTGTAGGTTTTGG -3'

Sequencing Primer
(F):5'- AGACGCGATGAGATTGTTCCC -3'
(R):5'- GCCCCAGGAGACAAAAAGATCAG -3'
Posted On2014-10-30