Incidental Mutation 'R2304:Sh2d6'
ID244524
Institutional Source Beutler Lab
Gene Symbol Sh2d6
Ensembl Gene ENSMUSG00000052631
Gene NameSH2 domain containing 6
Synonyms
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72513644-72521634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72520559 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 20 (E20G)
Ref Sequence ENSEMBL: ENSMUSP00000124673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089687] [ENSMUST00000159877] [ENSMUST00000162561]
Predicted Effect probably benign
Transcript: ENSMUST00000089687
SMART Domains Protein: ENSMUSP00000087117
Gene: ENSMUSG00000052631

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
SH2 184 276 3.15e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159877
SMART Domains Protein: ENSMUSP00000123776
Gene: ENSMUSG00000052631

DomainStartEndE-ValueType
low complexity region 117 130 N/A INTRINSIC
SH2 138 230 3.15e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160761
Predicted Effect probably damaging
Transcript: ENSMUST00000162561
AA Change: E20G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124673
Gene: ENSMUSG00000052631
AA Change: E20G

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
SH2 211 303 3.15e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Sh2d6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Sh2d6 APN 6 72519829 missense probably benign
IGL01386:Sh2d6 APN 6 72518962 missense probably benign 0.04
IGL02058:Sh2d6 APN 6 72513978 nonsense probably null
IGL02950:Sh2d6 APN 6 72515302 missense probably damaging 1.00
IGL02963:Sh2d6 APN 6 72517601 missense probably benign 0.01
R1981:Sh2d6 UTSW 6 72517544 splice site probably benign
R4520:Sh2d6 UTSW 6 72518953 missense possibly damaging 0.48
R4793:Sh2d6 UTSW 6 72517598 missense probably benign
R5079:Sh2d6 UTSW 6 72519850 missense probably benign 0.02
R7424:Sh2d6 UTSW 6 72517164 missense probably benign 0.05
RF013:Sh2d6 UTSW 6 72516388 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTTCTGCCCAGCTGAGAGG -3'
(R):5'- GAGCCAACCCATCTTTCCTG -3'

Sequencing Primer
(F):5'- AGCTGAGGCCCTTTTCTGC -3'
(R):5'- TTCCTGTCTGGCCCAGAGAC -3'
Posted On2014-10-30