Incidental Mutation 'R2304:Gkn3'
ID244525
Institutional Source Beutler Lab
Gene Symbol Gkn3
Ensembl Gene ENSMUSG00000030048
Gene Namegastrokine 3
Synonyms
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2304 (G1)
Quality Score90
Status Not validated
Chromosome6
Chromosomal Location87383256-87388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87383525 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000032127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032127] [ENSMUST00000032128]
Predicted Effect probably damaging
Transcript: ENSMUST00000032127
AA Change: A163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032127
Gene: ENSMUSG00000030048
AA Change: A163T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BRICHOS 63 155 1.47e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032128
SMART Domains Protein: ENSMUSP00000032128
Gene: ENSMUSG00000030049

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BRICHOS 54 151 6.63e-34 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Gkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Gkn3 APN 6 87383511 missense possibly damaging 0.70
IGL02746:Gkn3 APN 6 87387357 splice site probably benign
IGL03345:Gkn3 APN 6 87388816 missense probably null 0.09
R1758:Gkn3 UTSW 6 87388835 start codon destroyed probably benign
R2303:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2363:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2365:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2897:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2898:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2983:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3031:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3426:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3433:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4085:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4086:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4087:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4088:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4089:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4090:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4164:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4720:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4721:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4722:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4723:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4766:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4941:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5004:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6078:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6079:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6502:Gkn3 UTSW 6 87388804 missense probably benign 0.01
R6924:Gkn3 UTSW 6 87388802 missense probably benign 0.05
R7695:Gkn3 UTSW 6 87384440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGGGAAGCCAACATG -3'
(R):5'- TCTTCAAGACACAAGGGTCCC -3'

Sequencing Primer
(F):5'- TGTGGAGCACAGAGGACTGC -3'
(R):5'- CACACTGGGCTAAGGGGTTAC -3'
Posted On2014-10-30