Incidental Mutation 'R2304:Vmn1r184'
ID244526
Institutional Source Beutler Lab
Gene Symbol Vmn1r184
Ensembl Gene ENSMUSG00000046130
Gene Namevomeronasal 1 receptor, 184
Synonyms
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26260334-26270619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26267125 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000154576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057123] [ENSMUST00000227230] [ENSMUST00000227232] [ENSMUST00000227534] [ENSMUST00000227790] [ENSMUST00000228145] [ENSMUST00000228369]
Predicted Effect probably damaging
Transcript: ENSMUST00000057123
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061885
Gene: ENSMUSG00000046130
AA Change: S99P

DomainStartEndE-ValueType
Pfam:TAS2R 8 308 1.7e-7 PFAM
Pfam:V1R 35 297 7.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227230
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227232
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227534
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227790
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228145
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228369
AA Change: S99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Vmn1r184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn1r184 APN 7 26267437 missense probably damaging 1.00
IGL01411:Vmn1r184 APN 7 26266895 missense probably benign 0.06
IGL02961:Vmn1r184 APN 7 26267650 missense probably benign 0.27
IGL03271:Vmn1r184 APN 7 26267609 missense probably benign
R0302:Vmn1r184 UTSW 7 26267543 missense probably damaging 1.00
R0384:Vmn1r184 UTSW 7 26267651 missense probably benign 0.41
R0591:Vmn1r184 UTSW 7 26267075 missense probably damaging 0.98
R0620:Vmn1r184 UTSW 7 26267177 missense possibly damaging 0.46
R1644:Vmn1r184 UTSW 7 26267245 missense probably benign 0.00
R2329:Vmn1r184 UTSW 7 26266962 missense probably damaging 1.00
R3522:Vmn1r184 UTSW 7 26267583 nonsense probably null
R5020:Vmn1r184 UTSW 7 26267530 missense possibly damaging 0.87
R5030:Vmn1r184 UTSW 7 26267456 missense probably benign 0.25
R5049:Vmn1r184 UTSW 7 26267368 missense possibly damaging 0.49
R5076:Vmn1r184 UTSW 7 26266921 missense probably benign 0.00
R5213:Vmn1r184 UTSW 7 26267711 missense probably damaging 0.99
R5554:Vmn1r184 UTSW 7 26266988 missense probably damaging 1.00
R6146:Vmn1r184 UTSW 7 26267392 missense probably benign 0.08
R6868:Vmn1r184 UTSW 7 26267302 missense probably benign 0.00
R6937:Vmn1r184 UTSW 7 26267325 missense probably benign 0.08
R6943:Vmn1r184 UTSW 7 26267138 missense possibly damaging 0.77
R7190:Vmn1r184 UTSW 7 26267680 missense probably damaging 1.00
R7239:Vmn1r184 UTSW 7 26267177 missense possibly damaging 0.79
R7472:Vmn1r184 UTSW 7 26267399 missense possibly damaging 0.82
R8258:Vmn1r184 UTSW 7 26267261 missense probably benign 0.44
R8259:Vmn1r184 UTSW 7 26267261 missense probably benign 0.44
Z1177:Vmn1r184 UTSW 7 26266990 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACAAACTACAGTTGGAATTCTGG -3'
(R):5'- TTCAGGGAACATTACGAATGCTG -3'

Sequencing Primer
(F):5'- CTAGTCCTTTACTACAGAAAATGCAG -3'
(R):5'- GGAACATTACGAATGCTGCATAG -3'
Posted On2014-10-30