Incidental Mutation 'R2304:Prss53'
ID244529
Institutional Source Beutler Lab
Gene Symbol Prss53
Ensembl Gene ENSMUSG00000044139
Gene Nameprotease, serine 53
SynonymsBC039632
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127885841-127890970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127888307 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 291 (N291D)
Ref Sequence ENSEMBL: ENSMUSP00000145763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033074] [ENSMUST00000050383] [ENSMUST00000119922] [ENSMUST00000121394] [ENSMUST00000205300] [ENSMUST00000206053]
Predicted Effect probably benign
Transcript: ENSMUST00000033074
SMART Domains Protein: ENSMUSP00000033074
Gene: ENSMUSG00000096145

DomainStartEndE-ValueType
VKc 5 153 1.29e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050383
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119922
SMART Domains Protein: ENSMUSP00000112542
Gene: ENSMUSG00000096145

DomainStartEndE-ValueType
Pfam:VKOR 3 85 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121394
AA Change: N291D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139
AA Change: N291D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
AA Change: N291D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206053
Predicted Effect probably benign
Transcript: ENSMUST00000206340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Prss53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Prss53 APN 7 127886552 missense probably benign
IGL02244:Prss53 APN 7 127888792 missense possibly damaging 0.73
IGL02310:Prss53 APN 7 127886614 missense probably benign 0.37
PIT4515001:Prss53 UTSW 7 127888791 missense probably benign 0.01
R1933:Prss53 UTSW 7 127886262 makesense probably null
R1934:Prss53 UTSW 7 127886748 splice site probably null
R1994:Prss53 UTSW 7 127887393 missense probably benign 0.03
R2307:Prss53 UTSW 7 127890865 missense probably benign
R4934:Prss53 UTSW 7 127888707 missense probably benign
R6649:Prss53 UTSW 7 127886575 missense probably benign 0.37
R7854:Prss53 UTSW 7 127888945 missense probably benign 0.27
Z1088:Prss53 UTSW 7 127887398 nonsense probably null
Z1177:Prss53 UTSW 7 127889074 missense probably damaging 1.00
Z1177:Prss53 UTSW 7 127889549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCCTAAAAGGGGCCTTAGC -3'
(R):5'- TTCTGGCTCCAGGGAGATTC -3'

Sequencing Primer
(F):5'- AAGGGGCCTTAGCAAATCTCCTG -3'
(R):5'- ACCTGTGATGTGCCGTGAG -3'
Posted On2014-10-30