Mutagenetix > Incidental Mutations

Incidental Mutation 'R2304:Slc13a5'

244531

Institutional Source

Beutler Lab

Gene Symbol

Slc13a5

Ensembl Gene

ENSMUSG00000020805

Gene Name

solute carrier family 13 (sodium-dependent citrate transporter), member 5

Synonyms

Indy, Nact, mINDY, NaC2/NaCT

MMRRC Submission

040303-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72241989-72267222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72259039 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 172 (V172A)

Ref Sequence

ENSEMBL: ENSMUSP00000146762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000140167] [ENSMUST00000208056] [ENSMUST00000208912]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021161
AA Change: V215A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: V215A

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	8	558	1.3e-121	PFAM
Pfam:CitMHS	13	172	1.6e-14	PFAM
Pfam:CitMHS	202	498	6.4e-24	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000137701
AA Change: V215A

SMART Domains

Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: V215A

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	7	115	1.3e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140167

SMART Domains

Protein: ENSMUSP00000119822
Gene: ENSMUSG00000020805

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	6	102	7.9e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207990

Predicted Effect

probably damaging
Transcript: ENSMUST00000208056
AA Change: V198A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208912
AA Change: V172A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	A	5: 8,092,366	R806S	probably damaging	Het
Ccdc187	T	C	2: 26,281,017	K483R	possibly damaging	Het
Dcdc5	T	A	2: 106,336,143		noncoding transcript	Het
Dvl1	C	T	4: 155,855,584	S391F	probably damaging	Het
Erg28	A	G	12: 85,816,163	L125P	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm5449	G	T	13: 53,525,863		noncoding transcript	Het
Grid2ip	T	C	5: 143,387,840	Y796H	probably damaging	Het
Mcrip1	A	T	11: 120,544,693	F39I	probably damaging	Het
Olfr1135	T	A	2: 87,671,894	I158L	probably benign	Het
Prss53	T	C	7: 127,888,307	N291D	probably benign	Het
Ptpru	A	T	4: 131,772,568	V1255D	probably damaging	Het
Rbl1	T	C	2: 157,147,631	T1023A	probably benign	Het
Rnaseh2b	T	C	14: 62,361,389	S188P	probably damaging	Het
Sh2d6	T	C	6: 72,520,559	E20G	probably damaging	Het
Slco5a1	C	T	1: 12,879,262	G635S	probably damaging	Het
Sp8	G	T	12: 118,848,569	S53I	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Togaram1	G	T	12: 64,976,856		probably null	Het
Trip11	A	T	12: 101,898,977	F146I	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,125	S99P	probably damaging	Het
Xpot	T	C	10: 121,611,583	I325V	probably benign	Het
Zfp786	A	G	6: 47,820,699	L435P	probably damaging	Het

Other mutations in Slc13a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02347:Slc13a5	APN	11	72258954	splice site	probably null
IGL03392:Slc13a5	APN	11	72245178	missense	probably damaging	1.00
Punk	UTSW	11	72262076	missense	probably damaging	1.00
punk2	UTSW	11	72253391	missense	possibly damaging	0.65
R0018:Slc13a5	UTSW	11	72266475	missense	probably benign
R0018:Slc13a5	UTSW	11	72266475	missense	probably benign
R0042:Slc13a5	UTSW	11	72259114	missense	probably benign	0.31
R0194:Slc13a5	UTSW	11	72245233	missense	probably benign	0.22
R0194:Slc13a5	UTSW	11	72262130	missense	possibly damaging	0.95
R0234:Slc13a5	UTSW	11	72250800	missense	probably damaging	0.98
R1499:Slc13a5	UTSW	11	72250731	missense	probably damaging	0.97
R1655:Slc13a5	UTSW	11	72257378	missense	probably benign	0.00
R1728:Slc13a5	UTSW	11	72266459	splice site	probably null
R1818:Slc13a5	UTSW	11	72253343	missense	probably benign	0.02
R2352:Slc13a5	UTSW	11	72252321	missense	probably benign	0.06
R2408:Slc13a5	UTSW	11	72262076	missense	probably damaging	1.00
R2919:Slc13a5	UTSW	11	72247791	missense	possibly damaging	0.92
R2920:Slc13a5	UTSW	11	72247791	missense	possibly damaging	0.92
R3103:Slc13a5	UTSW	11	72257388	missense	probably damaging	1.00
R4772:Slc13a5	UTSW	11	72250846	critical splice acceptor site	probably null
R4906:Slc13a5	UTSW	11	72257418	missense	probably damaging	0.99
R5385:Slc13a5	UTSW	11	72259077	missense	probably benign	0.01
R5562:Slc13a5	UTSW	11	72262039	missense	probably damaging	0.99
R5878:Slc13a5	UTSW	11	72253391	missense	possibly damaging	0.65
R6173:Slc13a5	UTSW	11	72253197	missense	probably benign	0.05
R6665:Slc13a5	UTSW	11	72260360	missense	probably damaging	0.99
R7317:Slc13a5	UTSW	11	72245127	missense	probably damaging	1.00
R7338:Slc13a5	UTSW	11	72266484	missense	probably benign
R7908:Slc13a5	UTSW	11	72259064	missense	probably benign	0.00
R7989:Slc13a5	UTSW	11	72259064	missense	probably benign	0.00
R8038:Slc13a5	UTSW	11	72253370	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- ATCCTAGACTGATGGCTCCAGG -3'
(R):5'- GAAGAACACATGTGCACCTGG -3'

Sequencing Primer
(F):5'- TCCAGGCCAAGACAGGG -3'
(R):5'- GGTACGCCCGATCTCACATTAGTAG -3'

Posted On

2014-10-30