Incidental Mutation 'R2304:Slc13a5'
ID244531
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72259039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000146762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000140167] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect probably damaging
Transcript: ENSMUST00000021161
AA Change: V215A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: V215A

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137701
AA Change: V215A
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: V215A

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140167
SMART Domains Protein: ENSMUSP00000119822
Gene: ENSMUSG00000020805

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 102 7.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207990
Predicted Effect probably damaging
Transcript: ENSMUST00000208056
AA Change: V198A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000208912
AA Change: V172A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R7989:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATCCTAGACTGATGGCTCCAGG -3'
(R):5'- GAAGAACACATGTGCACCTGG -3'

Sequencing Primer
(F):5'- TCCAGGCCAAGACAGGG -3'
(R):5'- GGTACGCCCGATCTCACATTAGTAG -3'
Posted On2014-10-30