Incidental Mutation 'R2304:Mcrip1'
ID244532
Institutional Source Beutler Lab
Gene Symbol Mcrip1
Ensembl Gene ENSMUSG00000061111
Gene NameMAPK regulated corepressor interacting protein 1
SynonymsBC003940, Fam195b
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120542888-120549727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120544693 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 39 (F39I)
Ref Sequence ENSEMBL: ENSMUSP00000034913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034913]
Predicted Effect probably damaging
Transcript: ENSMUST00000034913
AA Change: F39I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034913
Gene: ENSMUSG00000061111
AA Change: F39I

DomainStartEndE-ValueType
Pfam:FAM195 4 94 3.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Mcrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
devonian UTSW 11 120544679 critical splice donor site probably null
R0184:Mcrip1 UTSW 11 120544884 start codon destroyed probably null 0.00
R2289:Mcrip1 UTSW 11 120544704 missense probably damaging 1.00
R7185:Mcrip1 UTSW 11 120544679 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGACCATCTCCCAGATCCTG -3'
(R):5'- TCTCAGGTGAATGTGGGAGC -3'

Sequencing Primer
(F):5'- AGATCCTGCCTCTTCTGGG -3'
(R):5'- AATGTGGGAGCTGGGACTCC -3'
Posted On2014-10-30