Incidental Mutation 'R2304:Sp8'
ID244536
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Nametrans-acting transcription factor 8
SynonymsmBtd, D930049B17Rik
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118846329-118852576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118848569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 53 (S53I)
Ref Sequence ENSEMBL: ENSMUSP00000152523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063918
AA Change: S53I

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: S53I

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223305
AA Change: S53I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118848970 missense probably damaging 1.00
IGL01783:Sp8 APN 12 118849024 missense probably benign 0.01
IGL02745:Sp8 APN 12 118849591 missense probably damaging 0.97
R0506:Sp8 UTSW 12 118848565 missense possibly damaging 0.73
R0699:Sp8 UTSW 12 118848820 small deletion probably benign
R1742:Sp8 UTSW 12 118849817 missense probably benign 0.04
R1771:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1776:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1791:Sp8 UTSW 12 118849016 missense possibly damaging 0.84
R1926:Sp8 UTSW 12 118849229 missense possibly damaging 0.55
R2159:Sp8 UTSW 12 118848706 missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118849738 missense probably damaging 0.99
R3777:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118848436 missense probably benign 0.33
R4360:Sp8 UTSW 12 118848665 missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118849203 missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118849070 missense probably damaging 0.98
R4982:Sp8 UTSW 12 118848425 missense probably damaging 0.99
R5053:Sp8 UTSW 12 118849604 missense probably damaging 1.00
R5347:Sp8 UTSW 12 118848511 missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118849087 missense probably damaging 0.96
R6219:Sp8 UTSW 12 118848667 missense probably benign 0.27
R7672:Sp8 UTSW 12 118849335 missense possibly damaging 0.47
R7793:Sp8 UTSW 12 118849409 missense probably damaging 0.98
R8548:Sp8 UTSW 12 118849175 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGAACCGAGGTTGGGATCC -3'
(R):5'- ACACAGAGTAGTCGTTGGC -3'

Sequencing Primer
(F):5'- AGGTTGGGATCCACTCCTCTG -3'
(R):5'- TAGTCGTTGGCAAAGGGC -3'
Posted On2014-10-30