Mutagenetix > Incidental Mutations

Incidental Mutation 'R2304:Sp8'

244536

Institutional Source

Beutler Lab

Gene Symbol

Sp8

Ensembl Gene

ENSMUSG00000048562

Gene Name

trans-acting transcription factor 8

Synonyms

mBtd, D930049B17Rik

MMRRC Submission

040303-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.698) question?

Stock #

R2304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118846329-118852576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 118848569 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 53 (S53I)

Ref Sequence

ENSEMBL: ENSMUSP00000152523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063918
AA Change: S53I

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: S53I

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	36	60	N/A	INTRINSIC
low complexity region	95	119	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	197	209	N/A	INTRINSIC
low complexity region	256	276	N/A	INTRINSIC
low complexity region	294	305	N/A	INTRINSIC
ZnF_C2H2	356	380	2.63e0	SMART
ZnF_C2H2	386	410	1.84e-4	SMART
ZnF_C2H2	416	438	7.9e-4	SMART
low complexity region	439	454	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223305
AA Change: S53I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	A	5: 8,092,366	R806S	probably damaging	Het
Ccdc187	T	C	2: 26,281,017	K483R	possibly damaging	Het
Dcdc5	T	A	2: 106,336,143		noncoding transcript	Het
Dvl1	C	T	4: 155,855,584	S391F	probably damaging	Het
Erg28	A	G	12: 85,816,163	L125P	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm5449	G	T	13: 53,525,863		noncoding transcript	Het
Grid2ip	T	C	5: 143,387,840	Y796H	probably damaging	Het
Mcrip1	A	T	11: 120,544,693	F39I	probably damaging	Het
Olfr1135	T	A	2: 87,671,894	I158L	probably benign	Het
Prss53	T	C	7: 127,888,307	N291D	probably benign	Het
Ptpru	A	T	4: 131,772,568	V1255D	probably damaging	Het
Rbl1	T	C	2: 157,147,631	T1023A	probably benign	Het
Rnaseh2b	T	C	14: 62,361,389	S188P	probably damaging	Het
Sh2d6	T	C	6: 72,520,559	E20G	probably damaging	Het
Slc13a5	A	G	11: 72,259,039	V172A	probably damaging	Het
Slco5a1	C	T	1: 12,879,262	G635S	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Togaram1	G	T	12: 64,976,856		probably null	Het
Trip11	A	T	12: 101,898,977	F146I	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,125	S99P	probably damaging	Het
Xpot	T	C	10: 121,611,583	I325V	probably benign	Het
Zfp786	A	G	6: 47,820,699	L435P	probably damaging	Het

Other mutations in Sp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Sp8	APN	12	118848970	missense	probably damaging	1.00
IGL01783:Sp8	APN	12	118849024	missense	probably benign	0.01
IGL02745:Sp8	APN	12	118849591	missense	probably damaging	0.97
R0506:Sp8	UTSW	12	118848565	missense	possibly damaging	0.73
R0699:Sp8	UTSW	12	118848820	small deletion	probably benign
R1742:Sp8	UTSW	12	118849817	missense	probably benign	0.04
R1771:Sp8	UTSW	12	118849567	missense	probably damaging	1.00
R1776:Sp8	UTSW	12	118849567	missense	probably damaging	1.00
R1791:Sp8	UTSW	12	118849016	missense	possibly damaging	0.84
R1926:Sp8	UTSW	12	118849229	missense	possibly damaging	0.55
R2159:Sp8	UTSW	12	118848706	missense	possibly damaging	0.83
R2223:Sp8	UTSW	12	118849738	missense	probably damaging	0.99
R3777:Sp8	UTSW	12	118849015	missense	possibly damaging	0.84
R3778:Sp8	UTSW	12	118849015	missense	possibly damaging	0.84
R3779:Sp8	UTSW	12	118849015	missense	possibly damaging	0.84
R4323:Sp8	UTSW	12	118848436	missense	probably benign	0.33
R4360:Sp8	UTSW	12	118848665	missense	possibly damaging	0.90
R4428:Sp8	UTSW	12	118849203	missense	possibly damaging	0.87
R4883:Sp8	UTSW	12	118849070	missense	probably damaging	0.98
R4982:Sp8	UTSW	12	118848425	missense	probably damaging	0.99
R5053:Sp8	UTSW	12	118849604	missense	probably damaging	1.00
R5347:Sp8	UTSW	12	118848511	missense	possibly damaging	0.91
R5755:Sp8	UTSW	12	118849087	missense	probably damaging	0.96
R6219:Sp8	UTSW	12	118848667	missense	probably benign	0.27
R7672:Sp8	UTSW	12	118849335	missense	possibly damaging	0.47
R7793:Sp8	UTSW	12	118849409	missense	probably damaging	0.98
R8548:Sp8	UTSW	12	118849175	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AAGAACCGAGGTTGGGATCC -3'
(R):5'- ACACAGAGTAGTCGTTGGC -3'

Sequencing Primer
(F):5'- AGGTTGGGATCCACTCCTCTG -3'
(R):5'- TAGTCGTTGGCAAAGGGC -3'

Posted On

2014-10-30