Incidental Mutation 'R2304:Gm5449'
ID244537
Institutional Source Beutler Lab
Gene Symbol Gm5449
Ensembl Gene ENSMUSG00000063166
Gene Namepredicted pseudogene 5449
Synonyms
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2304 (G1)
Quality Score91
Status Not validated
Chromosome13
Chromosomal Location53525703-53526059 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 53525863 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081132
SMART Domains Protein: ENSMUSP00000079907
Gene: ENSMUSG00000063166

DomainStartEndE-ValueType
Sm 32 111 1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223156
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Gm5449
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5302:Gm5449 UTSW 13 53525751 intron noncoding transcript
Predicted Primers PCR Primer
(F):5'- AATCCTAGGGACTATGCAAGATTG -3'
(R):5'- AGCACCACGATGAAGGAGTC -3'

Sequencing Primer
(F):5'- GTGATCTGCGAGCGAAACCTAC -3'
(R):5'- GAGTCCCCATGCAGGAACATCTTAG -3'
Posted On2014-10-30