Incidental Mutation 'R2304:Rnaseh2b'
ID244538
Institutional Source Beutler Lab
Gene Symbol Rnaseh2b
Ensembl Gene ENSMUSG00000021932
Gene Nameribonuclease H2, subunit B
SynonymsDleu8, 1110019N06Rik, 2610207P08Rik
MMRRC Submission 040303-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location62292589-62372992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62361389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 188 (S188P)
Ref Sequence ENSEMBL: ENSMUSP00000022499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022499] [ENSMUST00000169728]
PDB Structure
mouse RNase H2 complex [X-RAY DIFFRACTION]
The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022499
AA Change: S188P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022499
Gene: ENSMUSG00000021932
AA Change: S188P

DomainStartEndE-ValueType
Pfam:RNase_H2-Ydr279 14 298 6.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169728
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality associated with reduced cell proliferation and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I325V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Rnaseh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rnaseh2b APN 14 62365257 critical splice acceptor site probably null
IGL02475:Rnaseh2b APN 14 62346615 missense probably damaging 1.00
R1268:Rnaseh2b UTSW 14 62372455 missense possibly damaging 0.83
R1698:Rnaseh2b UTSW 14 62353632 missense probably benign 0.02
R2138:Rnaseh2b UTSW 14 62361345 missense probably benign
R3896:Rnaseh2b UTSW 14 62360457 splice site probably benign
R4717:Rnaseh2b UTSW 14 62353626 missense probably damaging 1.00
R5160:Rnaseh2b UTSW 14 62353531 nonsense probably null
R6360:Rnaseh2b UTSW 14 62361419 missense probably damaging 0.98
R8029:Rnaseh2b UTSW 14 62353548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAGCTGACAAAGATAACTCTAGGTGC -3'
(R):5'- GTTTGGTCACTATTAGGCCACG -3'

Sequencing Primer
(F):5'- CTCTAGGTGCTTAAATATTTCCTGG -3'
(R):5'- TGGTCACTATTAGGCCACGAGTAG -3'
Posted On2014-10-30