Incidental Mutation 'R0278:Rad23b'
ID 24454
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene Name RAD23 homolog B, nucleotide excision repair protein
Synonyms mHR23B, 0610007D13Rik
MMRRC Submission 038500-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0278 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 55350043-55392237 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 55383575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
AlphaFold P54728
PDB Structure The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030134
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,215 (GRCm39) S3429R probably damaging Het
Abca3 A G 17: 24,600,894 (GRCm39) D436G probably benign Het
Acacb C A 5: 114,371,320 (GRCm39) Y1816* probably null Het
Acer3 T C 7: 97,910,804 (GRCm39) Y86C probably damaging Het
Adgre1 A G 17: 57,754,872 (GRCm39) I657V probably benign Het
Akap1 A G 11: 88,736,020 (GRCm39) V214A probably benign Het
Ankrd42 T C 7: 92,280,865 (GRCm39) R22G possibly damaging Het
Apc2 C T 10: 80,148,647 (GRCm39) P1234S possibly damaging Het
Atp13a4 A G 16: 29,273,652 (GRCm39) I441T probably damaging Het
Cenpu G A 8: 47,031,344 (GRCm39) A242T probably damaging Het
Col6a6 A T 9: 105,644,487 (GRCm39) V1267E possibly damaging Het
Crhr2 T C 6: 55,094,516 (GRCm39) T58A probably benign Het
Ddx6 T G 9: 44,542,722 (GRCm39) C385G probably damaging Het
Dnah7a A T 1: 53,543,305 (GRCm39) N2288K probably benign Het
Egfl8 A T 17: 34,833,342 (GRCm39) probably null Het
Elmo2 A T 2: 165,139,287 (GRCm39) I420N probably damaging Het
Elovl4 A G 9: 83,665,248 (GRCm39) F113L probably benign Het
Fancd2 T A 6: 113,525,409 (GRCm39) probably null Het
Fbxl13 A G 5: 21,728,908 (GRCm39) V456A probably benign Het
Fgfr2 A T 7: 129,863,592 (GRCm39) probably null Het
Fkbpl A T 17: 34,864,384 (GRCm39) R51* probably null Het
Fn3krp G A 11: 121,312,406 (GRCm39) V40M probably damaging Het
Fnip1 A G 11: 54,380,169 (GRCm39) probably null Het
Gm15446 A T 5: 110,091,281 (GRCm39) Q511L probably benign Het
Gm7334 A G 17: 51,006,289 (GRCm39) K192E probably damaging Het
H2-Q10 A T 17: 35,784,204 (GRCm39) T282S possibly damaging Het
Hspa9 A G 18: 35,073,963 (GRCm39) V482A possibly damaging Het
Ica1l A T 1: 60,053,155 (GRCm39) S128T probably benign Het
Il7r A T 15: 9,516,423 (GRCm39) I126K probably damaging Het
Kcnj8 T C 6: 142,516,074 (GRCm39) E11G probably benign Het
Klkb1 A C 8: 45,725,446 (GRCm39) F498V probably benign Het
Lama1 A G 17: 68,117,178 (GRCm39) E2491G probably null Het
Lhfpl2 T C 13: 94,310,943 (GRCm39) V71A probably benign Het
Lin9 T C 1: 180,493,488 (GRCm39) I198T probably damaging Het
Lrrc7 T A 3: 157,885,432 (GRCm39) M431L possibly damaging Het
Nmt2 A G 2: 3,326,424 (GRCm39) T519A probably benign Het
Or10w1 C A 19: 13,632,128 (GRCm39) L112I probably damaging Het
Or10w1 T A 19: 13,632,129 (GRCm39) L112H probably damaging Het
Or1d2 T C 11: 74,256,028 (GRCm39) F178L probably damaging Het
Or4a74 G T 2: 89,440,108 (GRCm39) L113M probably damaging Het
Or4a74 A T 2: 89,440,107 (GRCm39) L113Q probably damaging Het
Or5al7 A T 2: 85,992,923 (GRCm39) Y123* probably null Het
Or7h8 G T 9: 20,124,182 (GRCm39) C179F probably damaging Het
Parp4 A G 14: 56,844,980 (GRCm39) R624G probably damaging Het
Pex16 C T 2: 92,211,401 (GRCm39) P325S probably damaging Het
Pik3ca T C 3: 32,493,902 (GRCm39) M288T possibly damaging Het
Pla2g5 C T 4: 138,527,967 (GRCm39) D100N probably benign Het
Prss43 T A 9: 110,656,430 (GRCm39) M39K probably benign Het
Psd4 T C 2: 24,284,450 (GRCm39) S105P probably damaging Het
Ptprz1 T A 6: 23,000,816 (GRCm39) S969T probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rpl10l A G 12: 66,331,130 (GRCm39) M1T probably null Het
Sec16a A G 2: 26,318,328 (GRCm39) S1588P probably damaging Het
Sh3rf1 A T 8: 61,827,052 (GRCm39) H602L probably damaging Het
Sparcl1 A T 5: 104,236,263 (GRCm39) S497T probably benign Het
Spata13 A G 14: 60,929,537 (GRCm39) Y365C probably benign Het
Trim5 T C 7: 103,928,882 (GRCm39) N20D probably benign Het
Vmn1r201 G T 13: 22,659,194 (GRCm39) W136L probably damaging Het
Vmn2r112 A G 17: 22,821,987 (GRCm39) I222V probably benign Het
Vmn2r56 A T 7: 12,449,644 (GRCm39) V198D probably damaging Het
Wapl A G 14: 34,414,569 (GRCm39) D477G possibly damaging Het
Zfp202 C A 9: 40,119,778 (GRCm39) H194N probably benign Het
Zfp212 C T 6: 47,903,453 (GRCm39) R13W probably damaging Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55,366,774 (GRCm39) splice site probably benign
IGL01326:Rad23b APN 4 55,383,601 (GRCm39) missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55,350,360 (GRCm39) utr 5 prime probably benign
IGL02506:Rad23b APN 4 55,382,511 (GRCm39) missense probably benign 0.01
IGL02538:Rad23b APN 4 55,370,457 (GRCm39) missense possibly damaging 0.67
Saguaro UTSW 4 55,370,474 (GRCm39) critical splice donor site probably null
R1846:Rad23b UTSW 4 55,383,637 (GRCm39) nonsense probably null
R2198:Rad23b UTSW 4 55,385,497 (GRCm39) missense possibly damaging 0.68
R2425:Rad23b UTSW 4 55,385,438 (GRCm39) missense probably damaging 0.99
R3774:Rad23b UTSW 4 55,382,589 (GRCm39) missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55,382,586 (GRCm39) missense probably damaging 1.00
R4197:Rad23b UTSW 4 55,385,455 (GRCm39) missense probably damaging 0.98
R5911:Rad23b UTSW 4 55,370,474 (GRCm39) critical splice donor site probably null
R6056:Rad23b UTSW 4 55,382,540 (GRCm39) missense probably benign 0.01
R6067:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R6078:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R6079:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R7426:Rad23b UTSW 4 55,370,469 (GRCm39) missense probably benign 0.00
U15987:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGAGGAGGCGTTGTTCTGGCTC -3'
(R):5'- GGAAGAGGAAGTAAGCCTTTCCCAAAC -3'

Sequencing Primer
(F):5'- CCTACTAGGTAATTTTGGTCCCTGAG -3'
(R):5'- CCTATGTAAGCTGATCAATCGTTC -3'
Posted On 2013-04-16