Mutagenetix > Incidental Mutations

Incidental Mutation 'R2304:Tns2'

244540

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

040303-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102108934 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 281 (R281C)

Ref Sequence

ENSEMBL: ENSMUSP00000155830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229035

Predicted Effect

probably benign
Transcript: ENSMUST00000229592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229908

Predicted Effect

probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2021

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	A	5: 8,092,366	R806S	probably damaging	Het
Ccdc187	T	C	2: 26,281,017	K483R	possibly damaging	Het
Dcdc5	T	A	2: 106,336,143		noncoding transcript	Het
Dvl1	C	T	4: 155,855,584	S391F	probably damaging	Het
Erg28	A	G	12: 85,816,163	L125P	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm5449	G	T	13: 53,525,863		noncoding transcript	Het
Grid2ip	T	C	5: 143,387,840	Y796H	probably damaging	Het
Mcrip1	A	T	11: 120,544,693	F39I	probably damaging	Het
Olfr1135	T	A	2: 87,671,894	I158L	probably benign	Het
Prss53	T	C	7: 127,888,307	N291D	probably benign	Het
Ptpru	A	T	4: 131,772,568	V1255D	probably damaging	Het
Rbl1	T	C	2: 157,147,631	T1023A	probably benign	Het
Rnaseh2b	T	C	14: 62,361,389	S188P	probably damaging	Het
Sh2d6	T	C	6: 72,520,559	E20G	probably damaging	Het
Slc13a5	A	G	11: 72,259,039	V172A	probably damaging	Het
Slco5a1	C	T	1: 12,879,262	G635S	probably damaging	Het
Sp8	G	T	12: 118,848,569	S53I	possibly damaging	Het
Togaram1	G	T	12: 64,976,856		probably null	Het
Trip11	A	T	12: 101,898,977	F146I	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,125	S99P	probably damaging	Het
Xpot	T	C	10: 121,611,583	I325V	probably benign	Het
Zfp786	A	G	6: 47,820,699	L435P	probably damaging	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2105:Tns2	UTSW	15	102107506	missense	probably benign	0.27
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4599:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4776:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7061:Tns2	UTSW	15	102104479	start codon destroyed	probably null
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGGATCTCATGATTCCTCC -3'
(R):5'- TCCTGTGGAGTCTTTCTTACAAGC -3'

Sequencing Primer
(F):5'- CCTTCCCTGGGGTTTAGGTATAGAAG -3'
(R):5'- GCCAGAACGATCTAGTCTGTTTACG -3'

Posted On

2014-10-30