Incidental Mutation 'R2305:Acvr1c'
ID244544
Institutional Source Beutler Lab
Gene Symbol Acvr1c
Ensembl Gene ENSMUSG00000026834
Gene Nameactivin A receptor, type IC
SynonymsALK7, Alk-7
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58267453-58357895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58281699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 295 (D295Y)
Ref Sequence ENSEMBL: ENSMUSP00000108227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608]
Predicted Effect probably damaging
Transcript: ENSMUST00000028178
AA Change: D375Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834
AA Change: D375Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.1e-13 PFAM
transmembrane domain 114 136 N/A INTRINSIC
GS 165 195 1.07e-13 SMART
Blast:TyrKc 201 472 3e-28 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000100085
AA Change: D245Y
SMART Domains Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834
AA Change: D245Y

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 1.1e-7 PFAM
Pfam:TGF_beta_GS 51 63 2.6e-7 PFAM
Pfam:Pkinase 65 352 5.6e-51 PFAM
Pfam:Pkinase_Tyr 65 352 4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112607
AA Change: D218Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834
AA Change: D218Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.5e-15 PFAM
Pfam:Pkinase 51 325 9.5e-37 PFAM
Pfam:Pkinase_Tyr 92 325 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112608
AA Change: D295Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834
AA Change: D295Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 4.9e-15 PFAM
Pfam:TGF_beta_GS 101 113 1.2e-8 PFAM
Pfam:Pkinase 115 402 2.3e-51 PFAM
Pfam:Pkinase_Tyr 115 402 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131189
Meta Mutation Damage Score 0.6089 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Acvr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Acvr1c APN 2 58315855 missense probably damaging 1.00
IGL00543:Acvr1c APN 2 58315823 missense probably damaging 1.00
IGL01287:Acvr1c APN 2 58280242 nonsense probably null
IGL01313:Acvr1c APN 2 58315974 missense probably benign 0.10
IGL01722:Acvr1c APN 2 58283549 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0329:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R0330:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R1311:Acvr1c UTSW 2 58280249 missense probably benign 0.04
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1511:Acvr1c UTSW 2 58287884 missense probably damaging 1.00
R1813:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1896:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1935:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1939:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1940:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R2001:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2002:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R4786:Acvr1c UTSW 2 58280354 missense probably damaging 1.00
R4947:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R5121:Acvr1c UTSW 2 58281650 missense probably damaging 1.00
R5133:Acvr1c UTSW 2 58283506 missense probably damaging 1.00
R5381:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5383:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5647:Acvr1c UTSW 2 58295964 missense probably damaging 1.00
R5988:Acvr1c UTSW 2 58315874 missense probably damaging 1.00
R6860:Acvr1c UTSW 2 58287705 missense probably damaging 1.00
R7137:Acvr1c UTSW 2 58283387 critical splice donor site probably null
R7200:Acvr1c UTSW 2 58315855 missense probably damaging 1.00
R7278:Acvr1c UTSW 2 58284936 missense probably damaging 1.00
R8029:Acvr1c UTSW 2 58296117 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCAGAAACAGTTCAGTATGGTGAGG -3'
(R):5'- TGTTGATCCTGCCACAATGTG -3'

Sequencing Primer
(F):5'- TTCAGTATGGTGAGGAGAAAATAAAG -3'
(R):5'- AAATGATGGCTGTGTCAATACTGTG -3'
Posted On2014-10-30