Incidental Mutation 'R2305:Defb21'
ID244545
Institutional Source Beutler Lab
Gene Symbol Defb21
Ensembl Gene ENSMUSG00000056544
Gene Namedefensin beta 21
SynonymsLOC228782, 4930525K10Rik
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152572744-152574944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152574871 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 89 (L89Q)
Ref Sequence ENSEMBL: ENSMUSP00000065102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053180] [ENSMUST00000070722]
Predicted Effect probably benign
Transcript: ENSMUST00000053180
SMART Domains Protein: ENSMUSP00000059585
Gene: ENSMUSG00000050645

DomainStartEndE-ValueType
Pfam:Defensin_big 2 60 3.4e-9 PFAM
Pfam:Defensin_beta_2 26 55 5.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070722
AA Change: L89Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065102
Gene: ENSMUSG00000056544
AA Change: L89Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Defensin_beta_2 33 62 1.4e-9 PFAM
low complexity region 76 86 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Defb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Defb21 APN 2 152574792 missense probably benign 0.33
IGL00795:Defb21 APN 2 152574745 missense probably benign 0.00
IGL01301:Defb21 APN 2 152574751 missense possibly damaging 0.85
IGL01686:Defb21 APN 2 152574901 unclassified probably benign
ANU18:Defb21 UTSW 2 152574751 missense possibly damaging 0.85
R2438:Defb21 UTSW 2 152574775 missense possibly damaging 0.71
R6805:Defb21 UTSW 2 152574869 missense probably benign 0.01
X0063:Defb21 UTSW 2 152573832 unclassified probably benign
Z1176:Defb21 UTSW 2 152573833 missense unknown
Predicted Primers PCR Primer
(F):5'- CGGTGCTAAGAAAAGATGCTTG -3'
(R):5'- TGGGGATGCTTTACACAGTAGG -3'

Sequencing Primer
(F):5'- AGATGCTTGAAAATTTTGGGGCAC -3'
(R):5'- TACCTAGAGTTACACAGTCACAGTGG -3'
Posted On2014-10-30