Mutagenetix > Incidental Mutations

Incidental Mutation 'R2305:Polr2b'

244552

Institutional Source

Beutler Lab

Gene Symbol

Polr2b

Ensembl Gene

ENSMUSG00000029250

Gene Name

polymerase (RNA) II (DNA directed) polypeptide B

Synonyms

RPB2

MMRRC Submission

040304-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.974) question?

Stock #

R2305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77310147-77349324 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 77320437 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031167]

Predicted Effect

probably benign
Transcript: ENSMUST00000031167

SMART Domains

Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
Pfam:RNA_pol_Rpb2_1	38	442	2.5e-69	PFAM
Pfam:RNA_pol_Rpb2_2	201	394	3.7e-57	PFAM
Pfam:RNA_pol_Rpb2_3	468	532	6.1e-25	PFAM
Pfam:RNA_pol_Rpb2_4	567	629	7.4e-27	PFAM
Pfam:RNA_pol_Rpb2_5	653	700	1.6e-22	PFAM
Pfam:RNA_pol_Rpb2_6	707	1080	4.5e-129	PFAM
Pfam:RNA_pol_Rpb2_7	1082	1174	3.3e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202146

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.8%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1c	C	A	2: 58,281,699	D295Y	probably damaging	Het
Adamts7	A	G	9: 90,180,711	D406G	probably benign	Het
Ankhd1	T	C	18: 36,642,926	S1443P	possibly damaging	Het
Casp8ap2	A	T	4: 32,646,411	K1828I	probably damaging	Het
Ccdc105	T	C	10: 78,748,502	T360A	probably damaging	Het
Cep135	T	C	5: 76,595,389		probably benign	Het
Cyp3a57	A	G	5: 145,381,280	D357G	probably damaging	Het
Defb21	T	A	2: 152,574,871	L89Q	possibly damaging	Het
Dnah5	A	T	15: 28,387,767	E3124V	probably benign	Het
Efcab7	A	G	4: 99,831,481	T67A	possibly damaging	Het
Exo1	C	T	1: 175,888,761	P148L	probably damaging	Het
Hps4	A	G	5: 112,346,661	I37V	probably damaging	Het
Krt9	T	A	11: 100,193,116	M30L	unknown	Het
Med25	C	A	7: 44,885,890	R37L	possibly damaging	Het
Olfr1335	T	G	4: 118,808,861	Q318H	probably benign	Het
Olfr1436	T	C	19: 12,299,087	E15G	probably benign	Het
Phf3	G	A	1: 30,805,475	Q1468*	probably null	Het
Phkb	A	G	8: 86,043,802	K900R	possibly damaging	Het
Pirb	G	A	7: 3,712,991	H755Y	probably benign	Het
Polq	A	T	16: 37,062,337	N1342I	probably damaging	Het
Pus1	C	A	5: 110,774,960	M232I	probably benign	Het
Serpina3a	C	A	12: 104,116,528	Q187K	probably benign	Het
Slit1	G	A	19: 41,611,016	P1032L	probably benign	Het
Syne1	C	T	10: 5,047,573	E465K	probably damaging	Het
Tlk2	T	G	11: 105,241,591	I217R	possibly damaging	Het
Tlr4	A	G	4: 66,840,101	D377G	probably damaging	Het
Tmtc1	T	C	6: 148,244,697	D866G	probably damaging	Het
Tubd1	T	A	11: 86,555,191	I219N	probably benign	Het
Ugt3a2	C	A	15: 9,351,117	P71T	probably benign	Het
Vmn1r64	A	G	7: 5,884,536	S3P	probably benign	Het

Other mutations in Polr2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02026:Polr2b	APN	5	77332252	missense	probably benign
IGL02069:Polr2b	APN	5	77343197	missense	probably benign	0.01
IGL03218:Polr2b	APN	5	77315917	missense	probably benign	0.03
R0007:Polr2b	UTSW	5	77340437	missense	probably benign	0.02
R0056:Polr2b	UTSW	5	77334535	missense	possibly damaging	0.55
R0076:Polr2b	UTSW	5	77326561	missense	possibly damaging	0.78
R0099:Polr2b	UTSW	5	77320950	splice site	probably benign
R0114:Polr2b	UTSW	5	77343263	missense	probably damaging	1.00
R0193:Polr2b	UTSW	5	77320076	missense	probably damaging	1.00
R0481:Polr2b	UTSW	5	77332082	missense	possibly damaging	0.90
R0607:Polr2b	UTSW	5	77313159	unclassified	probably benign
R1233:Polr2b	UTSW	5	77334565	missense	probably benign
R1597:Polr2b	UTSW	5	77326101	missense	probably damaging	1.00
R1674:Polr2b	UTSW	5	77326623	missense	possibly damaging	0.83
R1696:Polr2b	UTSW	5	77342648	missense	probably benign	0.12
R1704:Polr2b	UTSW	5	77342560	missense	possibly damaging	0.95
R1871:Polr2b	UTSW	5	77326527	splice site	probably benign
R2114:Polr2b	UTSW	5	77320970	missense	probably damaging	1.00
R2137:Polr2b	UTSW	5	77320346	missense	probably benign	0.18
R3921:Polr2b	UTSW	5	77326653	missense	probably damaging	1.00
R4027:Polr2b	UTSW	5	77348405	missense	possibly damaging	0.88
R4031:Polr2b	UTSW	5	77348405	missense	possibly damaging	0.88
R4526:Polr2b	UTSW	5	77326714	missense	probably damaging	1.00
R4750:Polr2b	UTSW	5	77332039	missense	possibly damaging	0.92
R4827:Polr2b	UTSW	5	77342551	missense	probably benign
R5244:Polr2b	UTSW	5	77343000	intron	probably benign
R5360:Polr2b	UTSW	5	77349146	missense	possibly damaging	0.90
R5628:Polr2b	UTSW	5	77313216	missense	probably damaging	0.98
R5928:Polr2b	UTSW	5	77345342	missense	probably damaging	1.00
R6009:Polr2b	UTSW	5	77320252	missense	probably benign
R6179:Polr2b	UTSW	5	77320977	missense	probably damaging	1.00
R6251:Polr2b	UTSW	5	77348294	missense	probably benign	0.00
R7209:Polr2b	UTSW	5	77343179	missense	probably damaging	1.00
R7303:Polr2b	UTSW	5	77321021	missense	probably benign	0.04
R7328:Polr2b	UTSW	5	77315999	missense	probably damaging	1.00
R7345:Polr2b	UTSW	5	77349119	missense	possibly damaging	0.55
R7471:Polr2b	UTSW	5	77321066	nonsense	probably null
R7581:Polr2b	UTSW	5	77326704	missense	probably damaging	1.00
R7697:Polr2b	UTSW	5	77320212	missense	probably damaging	1.00
R7699:Polr2b	UTSW	5	77340421	missense	probably benign	0.00
R7700:Polr2b	UTSW	5	77340421	missense	probably benign	0.00
R7956:Polr2b	UTSW	5	77320245	missense	probably benign	0.35
R7995:Polr2b	UTSW	5	77325767	missense	possibly damaging	0.96
R8015:Polr2b	UTSW	5	77336506	missense	probably damaging	1.00
R8247:Polr2b	UTSW	5	77320215	missense	possibly damaging	0.94
R8318:Polr2b	UTSW	5	77335729	missense	probably benign	0.00
X0054:Polr2b	UTSW	5	77348305	missense	probably damaging	0.97
Z1088:Polr2b	UTSW	5	77342722	missense	possibly damaging	0.95
Z1088:Polr2b	UTSW	5	77345401	missense	probably damaging	1.00
Z1176:Polr2b	UTSW	5	77331971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGAACAGCTGCAGACTCAG -3'
(R):5'- AACCGCTGGCAAATTTCTAATG -3'

Sequencing Primer
(F):5'- GCACCAGAAAACGTTCATAGG -3'
(R):5'- CATCAAGCACCCTGGAAGTGG -3'

Posted On

2014-10-30