Incidental Mutation 'R2305:Pus1'
ID244553
Institutional Source Beutler Lab
Gene Symbol Pus1
Ensembl Gene ENSMUSG00000029507
Gene Namepseudouridine synthase 1
SynonymsMPUS1, A730013B20Rik, mPus1p
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110773667-110780659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110774960 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 232 (M232I)
Ref Sequence ENSEMBL: ENSMUSP00000130814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031481] [ENSMUST00000031483] [ENSMUST00000041558] [ENSMUST00000086643] [ENSMUST00000112426] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000136483] [ENSMUST00000146458] [ENSMUST00000149208] [ENSMUST00000170468]
Predicted Effect probably benign
Transcript: ENSMUST00000031481
AA Change: M232I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031481
Gene: ENSMUSG00000029507
AA Change: M232I

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031483
AA Change: M262I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031483
Gene: ENSMUSG00000029507
AA Change: M262I

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 191 1.3e-11 PFAM
Pfam:PseudoU_synth_1 231 337 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041558
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086643
AA Change: M280I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083844
Gene: ENSMUSG00000029507
AA Change: M280I

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 208 1.2e-7 PFAM
Pfam:PseudoU_synth_1 249 355 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112426
AA Change: M186I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108045
Gene: ENSMUSG00000029507
AA Change: M186I

DomainStartEndE-ValueType
SCOP:d1dj0a1 48 116 1e-12 SMART
Pfam:PseudoU_synth_1 155 261 5.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112433
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112436
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132267
Predicted Effect probably benign
Transcript: ENSMUST00000136483
SMART Domains Protein: ENSMUSP00000115143
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 147 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146458
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146652
Predicted Effect probably benign
Transcript: ENSMUST00000149208
SMART Domains Protein: ENSMUSP00000115468
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
PDB:4J37|A 37 162 3e-57 PDB
SCOP:d1dj0a1 48 162 3e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170468
AA Change: M232I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130814
Gene: ENSMUSG00000029507
AA Change: M232I

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181141
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slow postnatal weight gain, impaired exercise endurance, and alterations in muscle metabolism related to mitochondrial content and oxidative capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Pus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Pus1 UTSW 5 110774854 missense probably benign 0.09
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0486:Pus1 UTSW 5 110779730 missense probably damaging 1.00
R1922:Pus1 UTSW 5 110777639 missense probably damaging 1.00
R4528:Pus1 UTSW 5 110774730 missense probably damaging 1.00
R4609:Pus1 UTSW 5 110780318 start codon destroyed probably null 0.06
R4846:Pus1 UTSW 5 110779930 intron probably benign
R5720:Pus1 UTSW 5 110777718 missense probably damaging 1.00
R6207:Pus1 UTSW 5 110777714 missense probably benign 0.12
R7123:Pus1 UTSW 5 110773932 makesense probably null
R7449:Pus1 UTSW 5 110774586 missense probably damaging 1.00
R7827:Pus1 UTSW 5 110779716 missense probably damaging 1.00
RF016:Pus1 UTSW 5 110776558 missense not run
Predicted Primers PCR Primer
(F):5'- TTTCAAAGTGAACCCTCTCCAG -3'
(R):5'- TGCCTTTGCTCACAAGGACC -3'

Sequencing Primer
(F):5'- GTGAACCCTCTCCAGGACTAAG -3'
(R):5'- CTCACAAGGACCGGGATGTAC -3'
Posted On2014-10-30