Incidental Mutation 'R2305:Hps4'
ID244554
Institutional Source Beutler Lab
Gene Symbol Hps4
Ensembl Gene ENSMUSG00000042328
Gene NameHPS4, biogenesis of lysosomal organelles complex 3 subunit 2
SynonymsBLOC-3, 2010205O06Rik, C130020P05Rik
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112343083-112378414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112346661 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 37 (I37V)
Ref Sequence ENSEMBL: ENSMUSP00000107978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031289] [ENSMUST00000035279] [ENSMUST00000112359] [ENSMUST00000146510]
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000035279
AA Change: I37V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047920
Gene: ENSMUSG00000042328
AA Change: I37V

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112359
AA Change: I37V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328
AA Change: I37V

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133708
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176737
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit hypopigmentation, prolonged bleeding associated with a platelet defect, reduced secretion of kidney lysosomal enzymes, and resistance to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Hps4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Hps4 APN 5 112364511 splice site probably benign
IGL02331:Hps4 APN 5 112369536 missense probably benign 0.03
IGL02410:Hps4 APN 5 112370227 missense probably benign 0.07
IGL02821:Hps4 APN 5 112375441 missense probably benign 0.02
R0748:Hps4 UTSW 5 112374914 missense probably damaging 1.00
R1487:Hps4 UTSW 5 112377999 nonsense probably null
R1891:Hps4 UTSW 5 112369556 splice site probably null
R2010:Hps4 UTSW 5 112369476 missense probably damaging 1.00
R3196:Hps4 UTSW 5 112364563 missense probably damaging 1.00
R4274:Hps4 UTSW 5 112375030 intron probably benign
R4878:Hps4 UTSW 5 112375368 missense probably benign 0.12
R4988:Hps4 UTSW 5 112378153 utr 3 prime probably benign
R5843:Hps4 UTSW 5 112349430 critical splice donor site probably null
R5896:Hps4 UTSW 5 112369485 missense probably benign 0.02
R6318:Hps4 UTSW 5 112346629 missense probably damaging 1.00
R7381:Hps4 UTSW 5 112375458 missense possibly damaging 0.86
R7781:Hps4 UTSW 5 112370522 missense probably benign 0.14
Z1177:Hps4 UTSW 5 112370377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCTGGCAACTGAGCAC -3'
(R):5'- CCTTGGGAATTTAAGATCCAGACAGG -3'

Sequencing Primer
(F):5'- TGGCAACTGAGCACCAAGC -3'
(R):5'- TCCAGACAGGAGGACAGCC -3'
Posted On2014-10-30