Incidental Mutation 'R2305:Phkb'
ID244560
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R2305 (G1)
Quality Score210
Status Validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86043802 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 900 (K900R)
Ref Sequence ENSEMBL: ENSMUSP00000050788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053771
AA Change: K900R

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: K900R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162305
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCACCCTGGATACGTCAGTC -3'
(R):5'- TCATTGCTGTCTACCCGTGG -3'

Sequencing Primer
(F):5'- CCTGGATACGTCAGTCCTGTG -3'
(R):5'- TGTCCTACAGGTGACGA -3'
Posted On2014-10-30