Incidental Mutation 'R2305:Ccdc105'
ID244564
Institutional Source Beutler Lab
Gene Symbol Ccdc105
Ensembl Gene ENSMUSG00000078442
Gene Namecoiled-coil domain containing 105
Synonyms4931413A09Rik
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78746926-78753065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78748502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 360 (T360A)
Ref Sequence ENSEMBL: ENSMUSP00000101022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105383]
Predicted Effect probably damaging
Transcript: ENSMUST00000105383
AA Change: T360A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101022
Gene: ENSMUSG00000078442
AA Change: T360A

DomainStartEndE-ValueType
Pfam:Tektin 115 470 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210562
Meta Mutation Damage Score 0.1421 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Ccdc105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ccdc105 APN 10 78750569 missense probably damaging 1.00
IGL01632:Ccdc105 APN 10 78748702 missense probably benign 0.01
IGL02473:Ccdc105 APN 10 78750594 missense probably benign 0.05
IGL02606:Ccdc105 APN 10 78748466 missense probably benign 0.01
IGL03356:Ccdc105 APN 10 78747132 missense possibly damaging 0.52
R0096:Ccdc105 UTSW 10 78748705 missense probably benign 0.01
R0096:Ccdc105 UTSW 10 78748705 missense probably benign 0.01
R0666:Ccdc105 UTSW 10 78750547 missense probably benign 0.04
R1756:Ccdc105 UTSW 10 78747197 missense probably damaging 0.96
R1757:Ccdc105 UTSW 10 78747224 missense probably benign 0.02
R1765:Ccdc105 UTSW 10 78748668 missense probably benign 0.21
R1956:Ccdc105 UTSW 10 78750539 critical splice donor site probably null
R3802:Ccdc105 UTSW 10 78748480 missense probably damaging 1.00
R3845:Ccdc105 UTSW 10 78748698 missense probably benign
R4023:Ccdc105 UTSW 10 78752893 missense probably benign 0.03
R4808:Ccdc105 UTSW 10 78752864 missense probably benign 0.02
R4812:Ccdc105 UTSW 10 78749216 missense probably benign 0.01
R5391:Ccdc105 UTSW 10 78752854 nonsense probably null
R5434:Ccdc105 UTSW 10 78748650 nonsense probably null
R6382:Ccdc105 UTSW 10 78752841 missense possibly damaging 0.90
R6743:Ccdc105 UTSW 10 78752892 missense probably benign 0.01
R6749:Ccdc105 UTSW 10 78752838 missense possibly damaging 0.95
R7177:Ccdc105 UTSW 10 78752490 missense probably damaging 1.00
X0057:Ccdc105 UTSW 10 78750541 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CGAACCAAGGGTCTGTTCAG -3'
(R):5'- ATAAGCAACCGTGTATGCTCCTC -3'

Sequencing Primer
(F):5'- GAACCAAGGGTCTGTTCAGTTTCTC -3'
(R):5'- CGTGTATGCTCCTCGCTGG -3'
Posted On2014-10-30