Incidental Mutation 'R2305:Tubd1'
ID244565
Institutional Source Beutler Lab
Gene Symbol Tubd1
Ensembl Gene ENSMUSG00000020513
Gene Nametubulin, delta 1
Synonyms4930550G19Rik
MMRRC Submission 040304-MU
Accession Numbers

Ncbi RefSeq: NM_001199045.1, NM_019756.3, NM_001199046.1, NM_001199047.1; MGI:1891826

Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86544991-86567360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86555191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 219 (I219N)
Ref Sequence ENSEMBL: ENSMUSP00000103665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020821] [ENSMUST00000069503] [ENSMUST00000108030] [ENSMUST00000167178]
Predicted Effect probably benign
Transcript: ENSMUST00000020821
AA Change: I219N

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020821
Gene: ENSMUSG00000020513
AA Change: I219N

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069503
AA Change: I219N

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064383
Gene: ENSMUSG00000020513
AA Change: I219N

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108030
AA Change: I219N

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103665
Gene: ENSMUSG00000020513
AA Change: I219N

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164931
SMART Domains Protein: ENSMUSP00000130621
Gene: ENSMUSG00000020513

DomainStartEndE-ValueType
Blast:Tubulin 2 27 1e-8 BLAST
SCOP:d1tubb2 37 184 2e-22 SMART
Blast:Tubulin 38 73 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167178
AA Change: I219N

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130909
Gene: ENSMUSG00000020513
AA Change: I219N

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Meta Mutation Damage Score 0.1800 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Krt9 T A 11: 100,193,116 M30L unknown Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Tubd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tubd1 APN 11 86565729 missense probably benign 0.07
IGL00465:Tubd1 APN 11 86555068 splice site probably benign
IGL03088:Tubd1 APN 11 86552999 missense probably damaging 1.00
IGL03383:Tubd1 APN 11 86549008 splice site probably benign
R0039:Tubd1 UTSW 11 86549395 nonsense probably null
R0427:Tubd1 UTSW 11 86557790 missense possibly damaging 0.94
R0482:Tubd1 UTSW 11 86557776 missense possibly damaging 0.89
R4153:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
R4436:Tubd1 UTSW 11 86548919 missense probably benign 0.02
R4773:Tubd1 UTSW 11 86555302 missense possibly damaging 0.83
R4793:Tubd1 UTSW 11 86567069 missense probably benign 0.19
R4890:Tubd1 UTSW 11 86552795 missense possibly damaging 0.83
R4908:Tubd1 UTSW 11 86567053 missense probably damaging 1.00
R4990:Tubd1 UTSW 11 86557839 missense probably damaging 1.00
R5004:Tubd1 UTSW 11 86561320 missense probably damaging 0.98
R6192:Tubd1 UTSW 11 86557793 missense probably benign 0.32
R7108:Tubd1 UTSW 11 86557805 missense probably damaging 0.99
Z1088:Tubd1 UTSW 11 86555167 missense probably damaging 1.00
Z1088:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTCCTGAGAGATATGAAATC -3'
(R):5'- ACTTTGGGTCTCTCAGAACATAC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGAACAAGCTG -3'
(R):5'- CGGTTTTTCTACAAGTAACAGAAGGG -3'
Posted On2014-10-30