Mutagenetix > Incidental Mutation

Incidental Mutation 'R0278:Sparcl1'

24457

Institutional Source

Beutler Lab

Gene Symbol

Sparcl1

Ensembl Gene

ENSMUSG00000029309

Gene Name

SPARC-like 1

Synonyms

hevin, Ecm2, mast9, Sc1

MMRRC Submission

038500-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0278 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104226977-104261599 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104236263 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 497 (S497T)

Ref Sequence

ENSEMBL: ENSMUSP00000031249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031249] [ENSMUST00000199947]

AlphaFold

P70663

Predicted Effect

probably benign
Transcript: ENSMUST00000031249
AA Change: S497T

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: S497T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	90	101	N/A	INTRINSIC
low complexity region	192	210	N/A	INTRINSIC
low complexity region	330	340	N/A	INTRINSIC
low complexity region	372	381	N/A	INTRINSIC
FOLN	418	441	2.33e-5	SMART
KAZAL	441	495	3.62e-11	SMART
Pfam:SPARC_Ca_bdg	498	636	2.8e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199947

SMART Domains

Protein: ENSMUSP00000143177
Gene: ENSMUSG00000029309

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	90	101	N/A	INTRINSIC
low complexity region	192	210	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.4%
20x: 90.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,328,215 (GRCm39)	S3429R	probably damaging	Het
Abca3	A	G	17: 24,600,894 (GRCm39)	D436G	probably benign	Het
Acacb	C	A	5: 114,371,320 (GRCm39)	Y1816*	probably null	Het
Acer3	T	C	7: 97,910,804 (GRCm39)	Y86C	probably damaging	Het
Adgre1	A	G	17: 57,754,872 (GRCm39)	I657V	probably benign	Het
Akap1	A	G	11: 88,736,020 (GRCm39)	V214A	probably benign	Het
Ankrd42	T	C	7: 92,280,865 (GRCm39)	R22G	possibly damaging	Het
Apc2	C	T	10: 80,148,647 (GRCm39)	P1234S	possibly damaging	Het
Atp13a4	A	G	16: 29,273,652 (GRCm39)	I441T	probably damaging	Het
Cenpu	G	A	8: 47,031,344 (GRCm39)	A242T	probably damaging	Het
Col6a6	A	T	9: 105,644,487 (GRCm39)	V1267E	possibly damaging	Het
Crhr2	T	C	6: 55,094,516 (GRCm39)	T58A	probably benign	Het
Ddx6	T	G	9: 44,542,722 (GRCm39)	C385G	probably damaging	Het
Dnah7a	A	T	1: 53,543,305 (GRCm39)	N2288K	probably benign	Het
Egfl8	A	T	17: 34,833,342 (GRCm39)		probably null	Het
Elmo2	A	T	2: 165,139,287 (GRCm39)	I420N	probably damaging	Het
Elovl4	A	G	9: 83,665,248 (GRCm39)	F113L	probably benign	Het
Fancd2	T	A	6: 113,525,409 (GRCm39)		probably null	Het
Fbxl13	A	G	5: 21,728,908 (GRCm39)	V456A	probably benign	Het
Fgfr2	A	T	7: 129,863,592 (GRCm39)		probably null	Het
Fkbpl	A	T	17: 34,864,384 (GRCm39)	R51*	probably null	Het
Fn3krp	G	A	11: 121,312,406 (GRCm39)	V40M	probably damaging	Het
Fnip1	A	G	11: 54,380,169 (GRCm39)		probably null	Het
Gm15446	A	T	5: 110,091,281 (GRCm39)	Q511L	probably benign	Het
Gm7334	A	G	17: 51,006,289 (GRCm39)	K192E	probably damaging	Het
H2-Q10	A	T	17: 35,784,204 (GRCm39)	T282S	possibly damaging	Het
Hspa9	A	G	18: 35,073,963 (GRCm39)	V482A	possibly damaging	Het
Ica1l	A	T	1: 60,053,155 (GRCm39)	S128T	probably benign	Het
Il7r	A	T	15: 9,516,423 (GRCm39)	I126K	probably damaging	Het
Kcnj8	T	C	6: 142,516,074 (GRCm39)	E11G	probably benign	Het
Klkb1	A	C	8: 45,725,446 (GRCm39)	F498V	probably benign	Het
Lama1	A	G	17: 68,117,178 (GRCm39)	E2491G	probably null	Het
Lhfpl2	T	C	13: 94,310,943 (GRCm39)	V71A	probably benign	Het
Lin9	T	C	1: 180,493,488 (GRCm39)	I198T	probably damaging	Het
Lrrc7	T	A	3: 157,885,432 (GRCm39)	M431L	possibly damaging	Het
Nmt2	A	G	2: 3,326,424 (GRCm39)	T519A	probably benign	Het
Or10w1	C	A	19: 13,632,128 (GRCm39)	L112I	probably damaging	Het
Or10w1	T	A	19: 13,632,129 (GRCm39)	L112H	probably damaging	Het
Or1d2	T	C	11: 74,256,028 (GRCm39)	F178L	probably damaging	Het
Or4a74	G	T	2: 89,440,108 (GRCm39)	L113M	probably damaging	Het
Or4a74	A	T	2: 89,440,107 (GRCm39)	L113Q	probably damaging	Het
Or5al7	A	T	2: 85,992,923 (GRCm39)	Y123*	probably null	Het
Or7h8	G	T	9: 20,124,182 (GRCm39)	C179F	probably damaging	Het
Parp4	A	G	14: 56,844,980 (GRCm39)	R624G	probably damaging	Het
Pex16	C	T	2: 92,211,401 (GRCm39)	P325S	probably damaging	Het
Pik3ca	T	C	3: 32,493,902 (GRCm39)	M288T	possibly damaging	Het
Pla2g5	C	T	4: 138,527,967 (GRCm39)	D100N	probably benign	Het
Prss43	T	A	9: 110,656,430 (GRCm39)	M39K	probably benign	Het
Psd4	T	C	2: 24,284,450 (GRCm39)	S105P	probably damaging	Het
Ptprz1	T	A	6: 23,000,816 (GRCm39)	S969T	probably benign	Het
Rad23b	T	A	4: 55,383,575 (GRCm39)		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,000,336 (GRCm39)		probably benign	Het
Rpl10l	A	G	12: 66,331,130 (GRCm39)	M1T	probably null	Het
Sec16a	A	G	2: 26,318,328 (GRCm39)	S1588P	probably damaging	Het
Sh3rf1	A	T	8: 61,827,052 (GRCm39)	H602L	probably damaging	Het
Spata13	A	G	14: 60,929,537 (GRCm39)	Y365C	probably benign	Het
Trim5	T	C	7: 103,928,882 (GRCm39)	N20D	probably benign	Het
Vmn1r201	G	T	13: 22,659,194 (GRCm39)	W136L	probably damaging	Het
Vmn2r112	A	G	17: 22,821,987 (GRCm39)	I222V	probably benign	Het
Vmn2r56	A	T	7: 12,449,644 (GRCm39)	V198D	probably damaging	Het
Wapl	A	G	14: 34,414,569 (GRCm39)	D477G	possibly damaging	Het
Zfp202	C	A	9: 40,119,778 (GRCm39)	H194N	probably benign	Het
Zfp212	C	T	6: 47,903,453 (GRCm39)	R13W	probably damaging	Het

Other mutations in Sparcl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Sparcl1	APN	5	104,240,788 (GRCm39)	missense	probably benign	0.04
IGL01291:Sparcl1	APN	5	104,242,581 (GRCm39)	missense	possibly damaging	0.88
IGL01958:Sparcl1	APN	5	104,240,406 (GRCm39)	missense	probably benign	0.30
IGL02749:Sparcl1	APN	5	104,240,746 (GRCm39)	missense	possibly damaging	0.57
IGL03034:Sparcl1	APN	5	104,241,103 (GRCm39)	missense	probably damaging	0.96
ANU05:Sparcl1	UTSW	5	104,242,581 (GRCm39)	missense	possibly damaging	0.88
R0007:Sparcl1	UTSW	5	104,234,946 (GRCm39)	missense	probably damaging	1.00
R0007:Sparcl1	UTSW	5	104,234,946 (GRCm39)	missense	probably damaging	1.00
R0071:Sparcl1	UTSW	5	104,233,707 (GRCm39)	nonsense	probably null
R0071:Sparcl1	UTSW	5	104,233,707 (GRCm39)	nonsense	probably null
R0360:Sparcl1	UTSW	5	104,237,503 (GRCm39)	missense	probably damaging	0.99
R0581:Sparcl1	UTSW	5	104,241,178 (GRCm39)	missense	probably damaging	0.99
R1755:Sparcl1	UTSW	5	104,240,690 (GRCm39)	missense	probably benign	0.12
R1807:Sparcl1	UTSW	5	104,233,627 (GRCm39)	missense	probably damaging	1.00
R1925:Sparcl1	UTSW	5	104,241,220 (GRCm39)	missense	probably benign	0.09
R2110:Sparcl1	UTSW	5	104,236,289 (GRCm39)	missense	probably damaging	1.00
R2112:Sparcl1	UTSW	5	104,236,289 (GRCm39)	missense	probably damaging	1.00
R2331:Sparcl1	UTSW	5	104,233,660 (GRCm39)	missense	probably damaging	1.00
R2567:Sparcl1	UTSW	5	104,232,954 (GRCm39)	missense	probably damaging	1.00
R3029:Sparcl1	UTSW	5	104,241,092 (GRCm39)	missense	possibly damaging	0.59
R3104:Sparcl1	UTSW	5	104,241,203 (GRCm39)	missense	probably benign	0.00
R3106:Sparcl1	UTSW	5	104,241,203 (GRCm39)	missense	probably benign	0.00
R3979:Sparcl1	UTSW	5	104,240,647 (GRCm39)	missense	probably benign	0.00
R4772:Sparcl1	UTSW	5	104,236,356 (GRCm39)	missense	probably benign	0.15
R4967:Sparcl1	UTSW	5	104,240,776 (GRCm39)	missense	probably damaging	1.00
R5095:Sparcl1	UTSW	5	104,233,629 (GRCm39)	missense	probably damaging	1.00
R5103:Sparcl1	UTSW	5	104,233,629 (GRCm39)	missense	probably damaging	1.00
R5105:Sparcl1	UTSW	5	104,233,629 (GRCm39)	missense	probably damaging	1.00
R5140:Sparcl1	UTSW	5	104,233,629 (GRCm39)	missense	probably damaging	1.00
R5149:Sparcl1	UTSW	5	104,233,629 (GRCm39)	missense	probably damaging	1.00
R6245:Sparcl1	UTSW	5	104,233,013 (GRCm39)	missense	probably damaging	1.00
R6387:Sparcl1	UTSW	5	104,232,926 (GRCm39)	missense	probably damaging	1.00
R6544:Sparcl1	UTSW	5	104,240,310 (GRCm39)	nonsense	probably null
R6930:Sparcl1	UTSW	5	104,234,940 (GRCm39)	missense	probably damaging	1.00
R7246:Sparcl1	UTSW	5	104,233,023 (GRCm39)	missense	probably benign	0.00
R8490:Sparcl1	UTSW	5	104,233,574 (GRCm39)	missense	probably null	1.00
R8860:Sparcl1	UTSW	5	104,241,218 (GRCm39)	missense	probably benign	0.25
R8899:Sparcl1	UTSW	5	104,240,590 (GRCm39)	missense	probably benign	0.01
R9047:Sparcl1	UTSW	5	104,240,979 (GRCm39)	missense	possibly damaging	0.90
R9215:Sparcl1	UTSW	5	104,240,701 (GRCm39)	missense	probably benign	0.05
R9284:Sparcl1	UTSW	5	104,236,345 (GRCm39)	nonsense	probably null
R9424:Sparcl1	UTSW	5	104,241,030 (GRCm39)	missense	possibly damaging	0.91
R9622:Sparcl1	UTSW	5	104,234,998 (GRCm39)	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AGAAACACTGAGTGGGCTGTCCTC -3'
(R):5'- GAGCACATCTTTGGCACAGCAC -3'

Sequencing Primer
(F):5'- CCAACGTGGTCTTGTAGAATCAG -3'
(R):5'- GAGTTCCAGGTAAGCATTCTCCAG -3'

Protein Function and Prediction

Sparcl1 encodes Hevin/Sc1, an matricellular secreted glycoprotein in the SPARC family (1). Hevin has three major domains: an N-terminal acidic domain, a follistatin-like domain, and the extracellular calcium-binding domain (1). The follistain-like domain is homologous to a domain in follistatin, a protein that inhibits members of the TGF-β superfamily (1). Hevin has been shown to inhibit the attachment and spreading of endothelial cells and to reduce focal adhesion formation by endothelial cells (2). Therefore, the proposed function of hevin is to modulate cell migration. Girard and Springer propose that hevin participates in lymphocyte transendothelial migration and might alter vascular permeability (2). The related protein, SPARC, functions as a cell cycle inhibitor, de-adhesive protein, a regulator of growth factor activity, and modulatory cell-matrix interactions (3).

Northern blot analysis detected expression of Sparcl1 in lymph node, brain, heart, lung, skeletal muscle, ovary, small intestine, and colon, with lower levels in placenta, pancreas, testis, spleen, and thymus, and no expression in kidney, liver, and peripheral blood leukocytes (4).

Sparcl1^{tm1Pmc/tm1Pmc}; MGI:2153047

involves: 129S1/Sv

Homozygotes exhibit stunted and less branched processes extending from extending from Purkinje cell bodies compared to in wild-type mice and exhibit an increase in glial cells compared to in wild-type mice (5).

Sparcl1^{tm1Pmc/tm1Pmc}; MGI:2153047

involves: 129S1/Sv * C57BL/6

Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival (6).

References

1. Sullivan, M. M., and Sage, E. H. (2004) Hevin/SC1, a Matricellular Glycoprotein and Potential Tumor-Suppressor of the SPARC/BM-40/Osteonectin Family. Int J Biochem Cell Biol. 36, 991-996.

2. Girard, J. P., and Springer, T. A. (1996) Modulation of Endothelial Cell Adhesion by Hevin, an Acidic Protein Associated with High Endothelial Venules. J Biol Chem. 271, 4511-4517.

3. Brekken, R. A., Sullivan, M. M., Workman, G., Bradshaw, A. D., Carbon, J., Siadak, A., Murri, C., Framson, P. E., and Sage, E. H. (2004) Expression and Characterization of Murine Hevin (SC1), a Member of the SPARC Family of Matricellular Proteins. J Histochem Cytochem. 52, 735-748.

4. Girard, J. P., and Springer, T. A. (1995) Cloning from Purified High Endothelial Venule Cells of Hevin, a Close Relative of the Antiadhesive Extracellular Matrix Protein SPARC. Immunity. 2, 113-123.

5. Weaver, M. S., Workman, G., Cardo-Vila, M., Arap, W., Pasqualini, R., and Sage, E. H. (2010) Processing of the Matricellular Protein Hevin in Mouse Brain is Dependent on ADAMTS4. J Biol Chem. 285, 5868-5877.

6. McKinnon, P. J., McLaughlin, S. K., Kapsetaki, M., and Margolskee, R. F. (2000) Extracellular Matrix-Associated Protein Sc1 is Not Essential for Mouse Development. Mol Cell Biol. 20, 656-660.

Posted On

2013-04-16

Science Writer

Anne Murray