Incidental Mutation 'R0278:Acacb'
ID 24458
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 038500-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0278 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114146535-114250761 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 114233259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1816 (Y1816*)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably null
Transcript: ENSMUST00000031583
AA Change: Y1816*
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: Y1816*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102582
AA Change: Y1816*
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: Y1816*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 (GRCm38) S3429R probably damaging Het
Abca3 A G 17: 24,381,920 (GRCm38) D436G probably benign Het
Acer3 T C 7: 98,261,597 (GRCm38) Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 (GRCm38) I657V probably benign Het
Akap1 A G 11: 88,845,194 (GRCm38) V214A probably benign Het
Ankrd42 T C 7: 92,631,657 (GRCm38) R22G possibly damaging Het
Apc2 C T 10: 80,312,813 (GRCm38) P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 (GRCm38) I441T probably damaging Het
Cenpu G A 8: 46,578,309 (GRCm38) A242T probably damaging Het
Col6a6 A T 9: 105,767,288 (GRCm38) V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 (GRCm38) T58A probably benign Het
Ddx6 T G 9: 44,631,425 (GRCm38) C385G probably damaging Het
Dnah7a A T 1: 53,504,146 (GRCm38) N2288K probably benign Het
Egfl8 A T 17: 34,614,368 (GRCm38) probably null Het
Elmo2 A T 2: 165,297,367 (GRCm38) I420N probably damaging Het
Elovl4 A G 9: 83,783,195 (GRCm38) F113L probably benign Het
Fancd2 T A 6: 113,548,448 (GRCm38) probably null Het
Fbxl13 A G 5: 21,523,910 (GRCm38) V456A probably benign Het
Fgfr2 A T 7: 130,261,862 (GRCm38) probably null Het
Fkbpl A T 17: 34,645,410 (GRCm38) R51* probably null Het
Fn3krp G A 11: 121,421,580 (GRCm38) V40M probably damaging Het
Fnip1 A G 11: 54,489,343 (GRCm38) probably null Het
Gm15446 A T 5: 109,943,415 (GRCm38) Q511L probably benign Het
Gm7334 A G 17: 50,699,261 (GRCm38) K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 (GRCm38) T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 (GRCm38) V482A possibly damaging Het
Ica1l A T 1: 60,013,996 (GRCm38) S128T probably benign Het
Il7r A T 15: 9,516,337 (GRCm38) I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 (GRCm38) E11G probably benign Het
Klkb1 A C 8: 45,272,409 (GRCm38) F498V probably benign Het
Lama1 A G 17: 67,810,183 (GRCm38) E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 (GRCm38) V71A probably benign Het
Lin9 T C 1: 180,665,923 (GRCm38) I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 (GRCm38) M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 (GRCm38) T519A probably benign Het
Olfr1043 A T 2: 86,162,579 (GRCm38) Y123* probably null Het
Olfr1247 A T 2: 89,609,763 (GRCm38) L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 (GRCm38) L113M probably damaging Het
Olfr1490 T A 19: 13,654,765 (GRCm38) L112H probably damaging Het
Olfr1490 C A 19: 13,654,764 (GRCm38) L112I probably damaging Het
Olfr412 T C 11: 74,365,202 (GRCm38) F178L probably damaging Het
Olfr871 G T 9: 20,212,886 (GRCm38) C179F probably damaging Het
Parp4 A G 14: 56,607,523 (GRCm38) R624G probably damaging Het
Pex16 C T 2: 92,381,056 (GRCm38) P325S probably damaging Het
Pik3ca T C 3: 32,439,753 (GRCm38) M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 (GRCm38) D100N probably benign Het
Prss43 T A 9: 110,827,362 (GRCm38) M39K probably benign Het
Psd4 T C 2: 24,394,438 (GRCm38) S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 (GRCm38) S969T probably benign Het
Rad23b T A 4: 55,383,575 (GRCm38) probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 (GRCm38) probably benign Het
Rpl10l A G 12: 66,284,356 (GRCm38) M1T probably null Het
Sec16a A G 2: 26,428,316 (GRCm38) S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 (GRCm38) H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 (GRCm38) S497T probably benign Het
Spata13 A G 14: 60,692,088 (GRCm38) Y365C probably benign Het
Trim5 T C 7: 104,279,675 (GRCm38) N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 (GRCm38) W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 (GRCm38) I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 (GRCm38) V198D probably damaging Het
Wapl A G 14: 34,692,612 (GRCm38) D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 (GRCm38) H194N probably benign Het
Zfp212 C T 6: 47,926,519 (GRCm38) R13W probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,200,289 (GRCm38) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,225,870 (GRCm38) missense probably benign 0.03
IGL01301:Acacb APN 5 114,246,498 (GRCm38) missense probably benign
IGL01633:Acacb APN 5 114,218,858 (GRCm38) splice site probably benign
IGL01736:Acacb APN 5 114,188,442 (GRCm38) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,200,520 (GRCm38) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,223,986 (GRCm38) splice site probably benign
IGL01933:Acacb APN 5 114,184,190 (GRCm38) splice site probably benign
IGL02028:Acacb APN 5 114,166,015 (GRCm38) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,240,660 (GRCm38) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,238,699 (GRCm38) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,223,878 (GRCm38) missense probably benign 0.00
IGL02445:Acacb APN 5 114,245,137 (GRCm38) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,192,105 (GRCm38) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,246,037 (GRCm38) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,218,881 (GRCm38) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,166,149 (GRCm38) splice site probably benign
IGL03110:Acacb APN 5 114,195,234 (GRCm38) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,204,805 (GRCm38) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,213,693 (GRCm38) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,225,854 (GRCm38) nonsense probably null
acetone UTSW 5 114,226,857 (GRCm38) nonsense probably null
anabolism UTSW 5 114,245,220 (GRCm38) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,225,870 (GRCm38) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,246,498 (GRCm38) missense probably benign
BB001:Acacb UTSW 5 114,245,220 (GRCm38) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,245,220 (GRCm38) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,238,655 (GRCm38) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,204,833 (GRCm38) splice site probably benign
R0219:Acacb UTSW 5 114,232,944 (GRCm38) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,209,817 (GRCm38) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,209,817 (GRCm38) missense probably damaging 0.99
R0607:Acacb UTSW 5 114,200,301 (GRCm38) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,229,752 (GRCm38) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,210,956 (GRCm38) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,245,092 (GRCm38) missense probably benign 0.00
R1204:Acacb UTSW 5 114,190,153 (GRCm38) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,200,512 (GRCm38) missense probably benign
R1415:Acacb UTSW 5 114,165,921 (GRCm38) missense probably benign
R1475:Acacb UTSW 5 114,195,252 (GRCm38) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,196,807 (GRCm38) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,201,940 (GRCm38) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,203,423 (GRCm38) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,195,285 (GRCm38) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,190,087 (GRCm38) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,209,767 (GRCm38) frame shift probably null
R1784:Acacb UTSW 5 114,209,767 (GRCm38) frame shift probably null
R1834:Acacb UTSW 5 114,235,475 (GRCm38) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,196,709 (GRCm38) missense probably benign 0.13
R1886:Acacb UTSW 5 114,218,959 (GRCm38) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,165,734 (GRCm38) nonsense probably null
R1902:Acacb UTSW 5 114,165,734 (GRCm38) nonsense probably null
R1903:Acacb UTSW 5 114,165,734 (GRCm38) nonsense probably null
R1924:Acacb UTSW 5 114,230,720 (GRCm38) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,198,282 (GRCm38) missense probably benign 0.27
R2051:Acacb UTSW 5 114,245,890 (GRCm38) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,209,767 (GRCm38) frame shift probably null
R2133:Acacb UTSW 5 114,209,767 (GRCm38) frame shift probably null
R2260:Acacb UTSW 5 114,216,917 (GRCm38) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,166,070 (GRCm38) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,212,636 (GRCm38) splice site probably null
R3729:Acacb UTSW 5 114,207,348 (GRCm38) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,213,651 (GRCm38) missense probably benign
R4245:Acacb UTSW 5 114,230,784 (GRCm38) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,241,921 (GRCm38) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,246,496 (GRCm38) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,226,831 (GRCm38) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,200,564 (GRCm38) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,204,763 (GRCm38) missense probably benign 0.01
R4720:Acacb UTSW 5 114,229,914 (GRCm38) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,232,938 (GRCm38) missense probably benign 0.04
R5044:Acacb UTSW 5 114,166,027 (GRCm38) missense probably benign 0.03
R5070:Acacb UTSW 5 114,246,028 (GRCm38) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,241,952 (GRCm38) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,244,551 (GRCm38) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,209,853 (GRCm38) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,204,706 (GRCm38) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,195,737 (GRCm38) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,230,832 (GRCm38) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,184,106 (GRCm38) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,229,851 (GRCm38) missense probably benign 0.01
R5911:Acacb UTSW 5 114,232,890 (GRCm38) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,245,980 (GRCm38) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,226,867 (GRCm38) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,165,600 (GRCm38) missense probably benign 0.43
R6103:Acacb UTSW 5 114,245,881 (GRCm38) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,212,652 (GRCm38) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,200,251 (GRCm38) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,216,823 (GRCm38) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,228,591 (GRCm38) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,191,963 (GRCm38) critical splice donor site probably null
R7138:Acacb UTSW 5 114,207,326 (GRCm38) missense probably benign 0.12
R7241:Acacb UTSW 5 114,245,100 (GRCm38) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,209,751 (GRCm38) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,213,661 (GRCm38) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,195,642 (GRCm38) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,218,862 (GRCm38) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,246,012 (GRCm38) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,165,738 (GRCm38) missense probably benign 0.13
R7868:Acacb UTSW 5 114,248,227 (GRCm38) missense probably benign 0.22
R7873:Acacb UTSW 5 114,223,278 (GRCm38) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,245,220 (GRCm38) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,166,047 (GRCm38) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,188,340 (GRCm38) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,230,861 (GRCm38) missense probably benign 0.00
R7972:Acacb UTSW 5 114,226,857 (GRCm38) nonsense probably null
R8007:Acacb UTSW 5 114,218,874 (GRCm38) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,223,854 (GRCm38) missense probably benign
R8030:Acacb UTSW 5 114,233,167 (GRCm38) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,195,236 (GRCm38) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,207,366 (GRCm38) missense probably benign 0.00
R8292:Acacb UTSW 5 114,200,494 (GRCm38) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,201,971 (GRCm38) nonsense probably null
R8693:Acacb UTSW 5 114,226,783 (GRCm38) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,213,380 (GRCm38) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,184,118 (GRCm38) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,195,254 (GRCm38) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,248,754 (GRCm38) splice site silent
R9044:Acacb UTSW 5 114,235,517 (GRCm38) missense probably benign 0.00
R9165:Acacb UTSW 5 114,216,683 (GRCm38) missense probably benign 0.01
R9231:Acacb UTSW 5 114,211,092 (GRCm38) missense probably benign 0.01
R9440:Acacb UTSW 5 114,246,024 (GRCm38) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,245,959 (GRCm38) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,233,336 (GRCm38) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,249,517 (GRCm38) missense probably benign 0.00
V1662:Acacb UTSW 5 114,238,708 (GRCm38) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,248,948 (GRCm38) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAAGACCCCGGAGTATCCAGAAG -3'
(R):5'- GCGTTCTGACTGAAACTCAGCGAG -3'

Sequencing Primer
(F):5'- TATCCAGAAGGCCGGGAC -3'
(R):5'- GTCACACTGATACCTAAGCTTTG -3'
Posted On 2013-04-16