Incidental Mutation 'R2306:Syt13'
ID244580
Institutional Source Beutler Lab
Gene Symbol Syt13
Ensembl Gene ENSMUSG00000027220
Gene Namesynaptotagmin XIII
Synonyms
MMRRC Submission 040305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2306 (G1)
Quality Score188
Status Validated
Chromosome2
Chromosomal Location92915098-92956058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92940967 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 133 (R133H)
Ref Sequence ENSEMBL: ENSMUSP00000028648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028648]
Predicted Effect probably benign
Transcript: ENSMUST00000028648
AA Change: R133H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028648
Gene: ENSMUSG00000027220
AA Change: R133H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:C2 165 277 5e-8 PFAM
C2 303 419 7.86e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the large synaptotagmin protein family. Family members have an extracellular N-terminal transmembrane domain and a cytoplasmic C terminus with two tandem C2 domains (C2A and C2B). Synaptotogmin family members can form homo- and heteromeric complexes with each other. They also have different biochemical properties and developmental profiles, and patterns of tissue distribution. Synaptotagmins function as membrane traffickers in multicellular organisms. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 G A 17: 42,713,119 H154Y possibly damaging Het
Arhgef7 T A 8: 11,812,680 Y501* probably null Het
Atmin T C 8: 116,957,650 F683S probably benign Het
Bcat1 A G 6: 145,007,653 V403A probably damaging Het
C4b T G 17: 34,728,518 M1729L probably benign Het
Cdh23 A G 10: 60,323,445 S2185P probably damaging Het
Crispld2 T G 8: 120,026,071 V286G probably damaging Het
Ctsw T C 19: 5,466,982 probably null Het
Dnaic1 T C 4: 41,625,239 V401A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Ifitm2 T A 7: 140,955,789 T43S probably damaging Het
Mark1 A T 1: 184,900,861 probably benign Het
Mme A G 3: 63,300,252 I40V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfatc2 A C 2: 168,590,103 F30C probably damaging Het
Npr2 T A 4: 43,633,609 V251D probably damaging Het
Pax8 T A 2: 24,443,045 Y96F probably damaging Het
Ppp1r13b T C 12: 111,844,893 E187G probably damaging Het
Rbp3 A T 14: 33,962,563 D1183V probably damaging Het
Reln T G 5: 21,896,786 D3382A probably damaging Het
Rfc3 A G 5: 151,643,778 L271P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdk1 C T 5: 141,962,700 A600V probably benign Het
Sfr1 T C 19: 47,734,852 I265T probably damaging Het
Tmem231 A T 8: 111,918,871 V132D probably damaging Het
Tmem247 C A 17: 86,918,441 A103E probably benign Het
Unc119b A T 5: 115,125,475 Y223* probably null Het
Vmn1r196 T A 13: 22,293,303 F37L probably benign Het
Vps13c T A 9: 67,987,993 Y3627N probably damaging Het
Zfp292 C A 4: 34,809,468 S1192I probably damaging Het
Other mutations in Syt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02236:Syt13 APN 2 92940865 missense probably damaging 0.96
IGL02332:Syt13 APN 2 92940804 missense probably benign 0.02
IGL03015:Syt13 APN 2 92951380 missense possibly damaging 0.94
R0345:Syt13 UTSW 2 92946067 missense possibly damaging 0.66
R0367:Syt13 UTSW 2 92915251 missense probably benign 0.01
R1160:Syt13 UTSW 2 92943042 splice site probably null
R1635:Syt13 UTSW 2 92953415 missense probably damaging 1.00
R1639:Syt13 UTSW 2 92945971 missense probably benign 0.04
R1844:Syt13 UTSW 2 92940820 missense probably damaging 1.00
R1869:Syt13 UTSW 2 92946103 missense possibly damaging 0.90
R2032:Syt13 UTSW 2 92953401 missense probably damaging 1.00
R2375:Syt13 UTSW 2 92946151 missense probably benign 0.02
R4958:Syt13 UTSW 2 92953449 missense probably damaging 1.00
R5341:Syt13 UTSW 2 92953552 missense probably benign 0.00
R7605:Syt13 UTSW 2 92943133 missense probably benign 0.27
X0024:Syt13 UTSW 2 92943075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCGCACCAACTAACCAG -3'
(R):5'- AACAGACTCTTCGTTTCTCACAG -3'

Sequencing Primer
(F):5'- TTAAAAAGTCCACGGAGCCTGTC -3'
(R):5'- CGTTTCTCACAGGAAAGCTG -3'
Posted On2014-10-30