Incidental Mutation 'R2306:Rfc3'
ID244589
Institutional Source Beutler Lab
Gene Symbol Rfc3
Ensembl Gene ENSMUSG00000033970
Gene Namereplication factor C (activator 1) 3
Synonyms2810416I22Rik, Recc3, 38kDa, 38kDa
MMRRC Submission 040305-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2306 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151642756-151651242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151643778 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 271 (L271P)
Ref Sequence ENSEMBL: ENSMUSP00000039621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038131]
Predicted Effect probably damaging
Transcript: ENSMUST00000038131
AA Change: L271P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039621
Gene: ENSMUSG00000033970
AA Change: L271P

DomainStartEndE-ValueType
AAA 34 190 1.5e-6 SMART
Pfam:Rep_fac_C 216 338 7.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202147
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 G A 17: 42,713,119 H154Y possibly damaging Het
Arhgef7 T A 8: 11,812,680 Y501* probably null Het
Atmin T C 8: 116,957,650 F683S probably benign Het
Bcat1 A G 6: 145,007,653 V403A probably damaging Het
C4b T G 17: 34,728,518 M1729L probably benign Het
Cdh23 A G 10: 60,323,445 S2185P probably damaging Het
Crispld2 T G 8: 120,026,071 V286G probably damaging Het
Ctsw T C 19: 5,466,982 probably null Het
Dnaic1 T C 4: 41,625,239 V401A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Ifitm2 T A 7: 140,955,789 T43S probably damaging Het
Mark1 A T 1: 184,900,861 probably benign Het
Mme A G 3: 63,300,252 I40V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfatc2 A C 2: 168,590,103 F30C probably damaging Het
Npr2 T A 4: 43,633,609 V251D probably damaging Het
Pax8 T A 2: 24,443,045 Y96F probably damaging Het
Ppp1r13b T C 12: 111,844,893 E187G probably damaging Het
Rbp3 A T 14: 33,962,563 D1183V probably damaging Het
Reln T G 5: 21,896,786 D3382A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdk1 C T 5: 141,962,700 A600V probably benign Het
Sfr1 T C 19: 47,734,852 I265T probably damaging Het
Syt13 G A 2: 92,940,967 R133H probably benign Het
Tmem231 A T 8: 111,918,871 V132D probably damaging Het
Tmem247 C A 17: 86,918,441 A103E probably benign Het
Unc119b A T 5: 115,125,475 Y223* probably null Het
Vmn1r196 T A 13: 22,293,303 F37L probably benign Het
Vps13c T A 9: 67,987,993 Y3627N probably damaging Het
Zfp292 C A 4: 34,809,468 S1192I probably damaging Het
Other mutations in Rfc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Rfc3 APN 5 151642936 missense probably benign 0.00
IGL02429:Rfc3 APN 5 151651131 missense probably benign 0.01
IGL02588:Rfc3 APN 5 151642916 missense possibly damaging 0.69
IGL02878:Rfc3 APN 5 151642914 makesense probably null
IGL03109:Rfc3 APN 5 151643094 missense probably benign 0.10
R0129:Rfc3 UTSW 5 151651151 start codon destroyed probably null 1.00
R0456:Rfc3 UTSW 5 151647523 missense possibly damaging 0.61
R2015:Rfc3 UTSW 5 151647538 critical splice acceptor site probably null
R2096:Rfc3 UTSW 5 151644918 missense probably benign 0.03
R4223:Rfc3 UTSW 5 151651172 start gained probably benign
R4739:Rfc3 UTSW 5 151644776 splice site probably benign
R4906:Rfc3 UTSW 5 151647495 missense probably damaging 0.98
R4945:Rfc3 UTSW 5 151642985 missense probably damaging 1.00
R5643:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R5644:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R6011:Rfc3 UTSW 5 151643719 missense probably damaging 1.00
R6181:Rfc3 UTSW 5 151647520 missense probably damaging 1.00
R6885:Rfc3 UTSW 5 151648284 missense probably benign 0.00
R7509:Rfc3 UTSW 5 151647510 missense probably damaging 1.00
R7587:Rfc3 UTSW 5 151651151 start codon destroyed probably null 1.00
Z1088:Rfc3 UTSW 5 151644862 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTGCATAACTGGGTTCC -3'
(R):5'- AAAATGAGCTGATCCTTGGTTG -3'

Sequencing Primer
(F):5'- GTGCATAACTGGGTTCCATTATTAC -3'
(R):5'- AAGCCAGTATGAGCTACCTCGTG -3'
Posted On2014-10-30