Incidental Mutation 'R2306:Tmem231'
ID244594
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Nametransmembrane protein 231
Synonyms
MMRRC Submission 040305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2306 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111912011-111933881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111918871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 132 (V132D)
Ref Sequence ENSEMBL: ENSMUSP00000034429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
Predicted Effect probably damaging
Transcript: ENSMUST00000034429
AA Change: V132D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951
AA Change: V132D

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211866
AA Change: S159T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.9355 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 G A 17: 42,713,119 H154Y possibly damaging Het
Arhgef7 T A 8: 11,812,680 Y501* probably null Het
Atmin T C 8: 116,957,650 F683S probably benign Het
Bcat1 A G 6: 145,007,653 V403A probably damaging Het
C4b T G 17: 34,728,518 M1729L probably benign Het
Cdh23 A G 10: 60,323,445 S2185P probably damaging Het
Crispld2 T G 8: 120,026,071 V286G probably damaging Het
Ctsw T C 19: 5,466,982 probably null Het
Dnaic1 T C 4: 41,625,239 V401A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Ifitm2 T A 7: 140,955,789 T43S probably damaging Het
Mark1 A T 1: 184,900,861 probably benign Het
Mme A G 3: 63,300,252 I40V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfatc2 A C 2: 168,590,103 F30C probably damaging Het
Npr2 T A 4: 43,633,609 V251D probably damaging Het
Pax8 T A 2: 24,443,045 Y96F probably damaging Het
Ppp1r13b T C 12: 111,844,893 E187G probably damaging Het
Rbp3 A T 14: 33,962,563 D1183V probably damaging Het
Reln T G 5: 21,896,786 D3382A probably damaging Het
Rfc3 A G 5: 151,643,778 L271P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdk1 C T 5: 141,962,700 A600V probably benign Het
Sfr1 T C 19: 47,734,852 I265T probably damaging Het
Syt13 G A 2: 92,940,967 R133H probably benign Het
Tmem247 C A 17: 86,918,441 A103E probably benign Het
Unc119b A T 5: 115,125,475 Y223* probably null Het
Vmn1r196 T A 13: 22,293,303 F37L probably benign Het
Vps13c T A 9: 67,987,993 Y3627N probably damaging Het
Zfp292 C A 4: 34,809,468 S1192I probably damaging Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 111918440 splice site probably benign
IGL02800:Tmem231 APN 8 111914032 missense probably benign 0.03
R2281:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R3615:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 111914592 missense probably benign 0.02
R4708:Tmem231 UTSW 8 111933786 start gained probably benign
R5522:Tmem231 UTSW 8 111918410 missense possibly damaging 0.92
R6266:Tmem231 UTSW 8 111915265 missense probably null 0.71
R6414:Tmem231 UTSW 8 111926892 intron probably benign
R6415:Tmem231 UTSW 8 111926892 intron probably benign
R6418:Tmem231 UTSW 8 111926892 intron probably benign
R6419:Tmem231 UTSW 8 111926892 intron probably benign
R6622:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R6938:Tmem231 UTSW 8 111933512 missense probably damaging 0.97
R7103:Tmem231 UTSW 8 111918885 synonymous probably null
R7221:Tmem231 UTSW 8 111933676 missense probably benign
R7305:Tmem231 UTSW 8 111915295 missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 111918408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCATCTGCAGTGTG -3'
(R):5'- TGAACTCAGATCTGCTTGTCTCTG -3'

Sequencing Primer
(F):5'- CTCAGAGGTTAAGAGCACTGACTG -3'
(R):5'- TGCCTCCCAAATGCTGG -3'
Posted On2014-10-30