Mutagenetix > Incidental Mutation

Incidental Mutation 'R2306:Adgrf2'

244604

Institutional Source

Beutler Lab

Gene Symbol

Adgrf2

Ensembl Gene

ENSMUSG00000057899

Gene Name

adhesion G protein-coupled receptor F2

Synonyms

Gpr111, PGR20

MMRRC Submission

040305-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2306 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42708936-42742179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42713119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 154 (H154Y)

Ref Sequence

ENSEMBL: ENSMUSP00000109244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113614]

AlphaFold

E9Q4J9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113614
AA Change: H154Y

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: H154Y

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
GPS	325	376	2.05e-4	SMART
Pfam:7tm_2	378	625	4.1e-29	PFAM

Meta Mutation Damage Score

0.0801

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.2%
20x: 94.4%

Validation Efficiency

100% (34/34)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef7	T	A	8: 11,812,680	Y501*	probably null	Het
Atmin	T	C	8: 116,957,650	F683S	probably benign	Het
Bcat1	A	G	6: 145,007,653	V403A	probably damaging	Het
C4b	T	G	17: 34,728,518	M1729L	probably benign	Het
Cdh23	A	G	10: 60,323,445	S2185P	probably damaging	Het
Crispld2	T	G	8: 120,026,071	V286G	probably damaging	Het
Ctsw	T	C	19: 5,466,982		probably null	Het
Dnaic1	T	C	4: 41,625,239	V401A	probably benign	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Ifitm2	T	A	7: 140,955,789	T43S	probably damaging	Het
Mark1	A	T	1: 184,900,861		probably benign	Het
Mme	A	G	3: 63,300,252	I40V	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Nfatc2	A	C	2: 168,590,103	F30C	probably damaging	Het
Npr2	T	A	4: 43,633,609	V251D	probably damaging	Het
Pax8	T	A	2: 24,443,045	Y96F	probably damaging	Het
Ppp1r13b	T	C	12: 111,844,893	E187G	probably damaging	Het
Rbp3	A	T	14: 33,962,563	D1183V	probably damaging	Het
Reln	T	G	5: 21,896,786	D3382A	probably damaging	Het
Rfc3	A	G	5: 151,643,778	L271P	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sdk1	C	T	5: 141,962,700	A600V	probably benign	Het
Sfr1	T	C	19: 47,734,852	I265T	probably damaging	Het
Syt13	G	A	2: 92,940,967	R133H	probably benign	Het
Tmem231	A	T	8: 111,918,871	V132D	probably damaging	Het
Tmem247	C	A	17: 86,918,441	A103E	probably benign	Het
Unc119b	A	T	5: 115,125,475	Y223*	probably null	Het
Vmn1r196	T	A	13: 22,293,303	F37L	probably benign	Het
Vps13c	T	A	9: 67,987,993	Y3627N	probably damaging	Het
Zfp292	C	A	4: 34,809,468	S1192I	probably damaging	Het

Other mutations in Adgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Adgrf2	APN	17	42714315	splice site	probably benign
IGL01089:Adgrf2	APN	17	42710158	missense	probably damaging	1.00
IGL01601:Adgrf2	APN	17	42710049	missense	probably benign
IGL01765:Adgrf2	APN	17	42719535	missense	probably benign	0.06
IGL02946:Adgrf2	APN	17	42710493	missense	probably damaging	1.00
R0498:Adgrf2	UTSW	17	42714315	splice site	probably benign
R0720:Adgrf2	UTSW	17	42713172	missense	probably damaging	1.00
R0831:Adgrf2	UTSW	17	42710443	missense	probably damaging	0.96
R1664:Adgrf2	UTSW	17	42714414	missense	possibly damaging	0.92
R2008:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.96
R2519:Adgrf2	UTSW	17	42710407	missense	probably damaging	1.00
R3713:Adgrf2	UTSW	17	42713088	missense	probably damaging	1.00
R3736:Adgrf2	UTSW	17	42711012	missense	probably benign	0.32
R4272:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.99
R4273:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.99
R4422:Adgrf2	UTSW	17	42713155	missense	probably benign
R4732:Adgrf2	UTSW	17	42710754	missense	probably damaging	1.00
R4733:Adgrf2	UTSW	17	42710754	missense	probably damaging	1.00
R4906:Adgrf2	UTSW	17	42711193	missense	probably benign
R5053:Adgrf2	UTSW	17	42710443	missense	probably damaging	0.96
R5078:Adgrf2	UTSW	17	42710986	missense	probably damaging	1.00
R5089:Adgrf2	UTSW	17	42710097	missense	probably benign	0.00
R5147:Adgrf2	UTSW	17	42710683	missense	probably damaging	0.99
R5953:Adgrf2	UTSW	17	42710338	missense	probably damaging	1.00
R5968:Adgrf2	UTSW	17	42715172	critical splice donor site	probably null
R6791:Adgrf2	UTSW	17	42710883	missense	probably benign	0.02
R7138:Adgrf2	UTSW	17	42710983	missense	probably damaging	1.00
R7612:Adgrf2	UTSW	17	42714380	missense	possibly damaging	0.68
R7670:Adgrf2	UTSW	17	42711372	missense	probably damaging	1.00
R8291:Adgrf2	UTSW	17	42710560	missense	probably damaging	1.00
R8418:Adgrf2	UTSW	17	42710586	missense	probably benign	0.01
R8510:Adgrf2	UTSW	17	42719540	nonsense	probably null
R9736:Adgrf2	UTSW	17	42711321	missense	probably benign	0.42
X0061:Adgrf2	UTSW	17	42713074	missense	probably benign	0.37
X0067:Adgrf2	UTSW	17	42710668	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATAAGATTTATTGAGTGCTGGC -3'
(R):5'- TGTTTCCAGGAGGATAAGGAAC -3'

Sequencing Primer
(F):5'- TGCTGGCTATGTGGGAAAATAG -3'
(R):5'- TTCCAGGAGGATAAGGAACTATATTC -3'

Posted On

2014-10-30